>Intergenic-ZYRO0F18568g-ZYRO0F18524g zrou_Chr_6 complement(1529749..1532754) 3006bp
AGTAGTTCTGCAATCACTTCACAACTATGGGGGAAGAATGATGGAATATTTCAGCTATAC
TTTGAGCTTCTTTCACAATTTGAAGAGCACTGGCATCTAAACATTTATCCTGAGTATCGT
TACCATAAGGTCAATAAAATAAGTCGGCAACTCGAAAATAAGCTCGTCTATCAGAATATG
TTAGATCGAATGCGCTATTTCACCGCTTCTTCGCTCATCGCCAATTTGGAAGATATCCTA
ATACTCCCCCCGGCGCACCCTCCCCCATCCTCCTCCACCTACACATACCCGGCCCTGCGG
CGTCCTGCCGCCGCCGCCGCCGCCGCCAAAGCGCAAGCACAAGCACAAGCACAAGCACAA
GCCGCCAACGCCCAAGCCGCCAACCCTGCCGCCCCAGCCCCACCTGCAACCAACGCTGAG
AGAAATGCAAAAACAAAACCCGCCCCCGGCGGCAAAGTCTCCAAGCAGCGAATCCACCCC
AAGAAAAAACCATCGCCCCCGCCCCGCCTCCGCCGCCCCGCCTCCGCCGTCCAGCAAATC
GCTTGTCACTTAATGGTTTTTAATAGCATTGTGGATATTTCACAGAAGATTCATCCAGTA
AGTATAGAACACTATTTTAGAATGCACAAAATAACTTTTTGAGTATATTGAATTAATATA
TACAGCCCTTCTTTGACGACATATTCCTTAGAACTGATTAGAGCATTGGTATTTTGATGA
CTTTAATGTCGTTGGCTTCCGAGATGAGAAGTTTTCAGGGTTGAGCCGCCAAAAAAATAA
GAATGGAGGAATTTTATCTTTCCATTGGGCAGTGTCTTTTCGGTATGTTAGAGGATGCGT
TGTTTATATGTGTTCTTGAGTTTACATATTCTCTAAGCTACACTTTTTCAATGGTGACTG
AGAGACGAGAATATGTAGTTGAATTATGCAAACTCCTATATGTTGGAAAATAAAGTATGT
ATTTTTACAATTTTTCTGGAATTACTTGAATTAGCTGCATATCCTATTTAGAAGGTTTCG
GATAATAGATAGAACCGCATTTCATTTGCTTGCTTTGATGTAGCTCTTGTACCTTGGGGA
TAACTCTCTTTCGTTGTGTTGGACAAGAATTGCTTGTGAGCTATCTCTATAAAACTGCAG
TTTTAGTCTTAAGTAACACTACATCATAATGAACAAAATTTCCTAATCTGGACGCTCTGG
TTTCCAATTTCGGACACAATCGCTTTCCTATTAAGGACCCTTTTCCTAATCCGGATGCTC
TTACCTTCCTATTAGAGACATACATATAACTCGTTACACAAGTTCCAGTGGTGAAAAAAA
ATGATTTTTGAAGAGCACAACCTAATAACGTATTCTGGCTCCTTTTTGCGCTTTAGAGCT
ATGATTTATGGAGCGCAAAGGTGCCAAAAGATGTTTTTCATTCGAACAAGTATATGATAA
GCGAGCTCTAGATTATTTCCTTCAGGATTTAGGATGATCTTGGAGGTGAGGATAAATGCA
ATCTAATGAAAAGGATTCTTCATAGAACGGGGTATGGAAAACTTTTCAGGTTGAGAATAC
ATAATATTTGTTCTAGTTTTTCTTTTTTTTTATTTTCCGTTGTTGTACAATCAGTGAATT
TTCTCTACTTTATCTTCGAAAAATTCGTCTCTCTAACTTTGGTATACATTACCAGTAAGT
AGGTTTAGAAGATCTAATTAAGGTTGAAATAAACATCAATAGTACACCTATTATGAAGTT
TTCCTCTCTTGTTTTATTTGAAGCTTTGCATAATTCTTTAATCAAGAGATCTGTTGTGTA
TACTTTTTTACTTACAAGCATTTGGTAGTTGCAAGCTTACCTAATGTCTGAAAATTACAC
ATGGTTTTTTGAATATCTCATGCGTATTGGAATCAGATCGTGGATCTTTGCATTGAAAAA
GATGGTTCGTTAGTTCGTCTGCCAGCTACATTAGTTTTTTACATAGTTTCTCGCCCTAAC
TTCCTTTTCTTCTTTTTAGTGGGGTAATGACTGAGTTCTCTTGGCATCAATGGCATCTTA
CATATTGAGGACGGGGTATAAGTATAGCGGTAACTTATAATACAATTTGCTTTCAATTGA
TTCTCAAAACTATTAGAGGGTTAGACTTTAATATTTCAATAGCTTGTGTTTCTGAATAAG
ATTTTCTGGAGTTGAACAGAGTTTTTGATAAATAGTTTGGTCTTAAAGGAATTTCGTGGA
TGTGGTATATCGCTAGTCTGCAAAATTTTGTCGTCATGTATTTACCGGACTTGGTGTGCC
AAAGAAAACACCATATTGAAAAAGTGCGCTACCTTACCATGAGTTTGTAATGTATCTATG
ACCCCAGTAGTATAGATAAATTTTCCCTTGAACTACTTGTACCAAAGGGCTATGCTTAAT
TTAGATTCTCTCATGTTTTTAACTTGAAACCATGTAATTCTGTTAGTTTGAATATTAAAT
TTATTAAAACCTTGGTCGGTACAAGCATAATAACTTCAACCCATATCTTACCTCTTAACT
CTCCTCTGAACTACTTCTAGAAAATTTTCTAGGATATACATTAAATGAGGAAAGGTGTTC
TTAATGCTCAGATAGAACTTTGTTCTTAAGTATTTGTTGCCGCTGTTAACAAACATTCTA
TTCTTCTGGGTAGTTTTGTAAGGGTGGTTTCCTTCAAAGTAACCAACTTACTTGATTATG
GAGGCTTTCCTTGAGGCTGTAAAAATTAGGCCTAATAAAACAAAAAGAATTTAACCCTCA
AAATTTTTCCTCTGTTCTAATATTAATTTACAAGATGATGGGCCATGTTAGGATCTGAAT
ATATATGACAATATTTATGGGTTATTATACTTTGTTATAAATTATGTCTTGTTCTTTATA
GATAACTTTGATACTTCGTAGCTGGAACCACTACTGAACGCGCGAACCTATCTCAGAGCG
TTTGTAGGAAGAGATCATTTAATATTCAAGAAGTAAAACTGAATAACGGTGTAAGCCCAG
CATTAA

The gene ZYRO0F18546g complement(1532113..1532577) is annotated in this region but switched OFF
truncated copy of a2 gene in X region flanking HMLalpha
no similarity