>Intergenic-YPR149W-YPR151C scer_Chr_16 (830440..831054) 615bp
TTGAAGCGCACCAACTTAAATTTTACGCCACTTTCAATTAAGAATATAATAAATGGACAC
CGTGAATAAATTAGGGAAAAAAGAAAGCAAATAAGAAAACTCCGTTTTCCCTCATCCCTT
TCCGTCTTTCGGAAGAAACAAAAAATTATACCCAAGGAAAACCCGAAAAAAATGAAAAAA
ATACCAGAAAAAAAATAACAAATCATATGCACTTCTTCATTAACGATTATGAAGAAGTCT
TATTTCTAACTAATATTATTATTATTATTATTATTATTATCATTCACCCCGCTTTCTTTT
ATTATAATTTGTTCTTCTAATATTTTAATTTTTAATCTTTTCATACTATTCTTATATCTA
ACTAAAGTATCCTTCTCTTTGTCTAGTTTTACTTCACTACATACCTGTTGCGTTGATTTG
AGTTTTTTGTATGTAAGTTCTGTTTATCCTTTTTCATCCTACCGTTCCGCGCACGGCGTG
ACGTGGATCCCTAATGTGAGTTCAAATCGGTTACAAAAATTAATAGTTTTGTTTCCTATT
ATTATTATTATTATTATGTATGAGGAATCGTGCTATAAAATCATTTTCCATATGTATATG
CCAAATATTTATTAT

The gene YPR150W (830999..831520) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the verified gene SUE1/YPR151C