>Intergenic-YPR151C-YPR149W scer_Chr_16 complement(830440..831054) 615bp
ATAATAAATATTTGGCATATACATATGGAAAATGATTTTATAGCACGATTCCTCATACAT
AATAATAATAATAATAATAGGAAACAAAACTATTAATTTTTGTAACCGATTTGAACTCAC
ATTAGGGATCCACGTCACGCCGTGCGCGGAACGGTAGGATGAAAAAGGATAAACAGAACT
TACATACAAAAAACTCAAATCAACGCAACAGGTATGTAGTGAAGTAAAACTAGACAAAGA
GAAGGATACTTTAGTTAGATATAAGAATAGTATGAAAAGATTAAAAATTAAAATATTAGA
AGAACAAATTATAATAAAAGAAAGCGGGGTGAATGATAATAATAATAATAATAATAATAA
TATTAGTTAGAAATAAGACTTCTTCATAATCGTTAATGAAGAAGTGCATATGATTTGTTA
TTTTTTTTCTGGTATTTTTTTCATTTTTTTCGGGTTTTCCTTGGGTATAATTTTTTGTTT
CTTCCGAAAGACGGAAAGGGATGAGGGAAAACGGAGTTTTCTTATTTGCTTTCTTTTTTC
CCTAATTTATTCACGGTGTCCATTTATTATATTCTTAATTGAAAGTGGCGTAAAATTTAA
GTTGGTGCGCTTCAA

The gene YPR150W (830999..831520) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the verified gene SUE1/YPR151C