>Intergenic-YOR299W-YOR301W scer_Chr_15 (880676..880964) 289bp
ATACGATAAAAAGACATTAATACGTATATATAATCCAAAAAAAATTGGCGATACGCTTCA
ACGTTGTGTCAAACTCTTGGGTCACTTTAAAGAAAACCCAGCATACATTAATACAGAGCA
ATGCTGGTTATGTAACTTCGCCGCCCGCCGCCATTCGAGGAAAAATATTCGTGTTTCGAG
AATGCGGGCAAAACGAAAATATCAATAAAACACATACGGGAAATTCATTGTGCACAACGA
CCTCTAACAATTTCTGCCAAAAAGAAAGTTCAAGAGCGTCCCATTCATC

The gene YOR300W (880575..880883) is annotated in this region but switched OFF
Dubious open reading frame, unlikely to encode a protein; overlaps with verified gene BUD7/YOR299W; mutation affects bipolar budding and bud site selection, though phenotype could be due to the mutation's effects on BUD7