>Intergenic-YMR272C-YMR273C scer_Chr_13 (810778..811232) 455bp
CTTCGTACTAGTTTTAGCTTACCACCGCTTTTAGTGCCTGCCACGATAACAATAGAAAAA
AAAACTAATCAAAGACAATAGACACAATAGCTTCTACTATCTAATACCTCTGTTCTTATA
CGGTTCCAAATTGAAAAAAAAATTAACTGCGAAAAGATGTCACACGTCAGTAAATCCGCG
CAAAACCCCGTTATATTTCCGACGTCGTGCGGTAGTTTCTGCGCGGAACGGCCCCGCGGA
ATAGGCACATTTTCTTCCGGCCGCAGAAAGCTCTCTTTATCAAAAGCAAGACTGTTTTCG
GCTATTGTATTATGAGAAGTTTGGTGTTTGTCCAACTTTCCCTGTTGTCCTGGGAAATAT
TCTGTGGGGAACGTAGCTTTGTGAGCATGAAAGCTATCTTTTCGTGTATGTACGTGTGAT
GTGTATATGTCTATGTATGCAGCGCTGAAGCCTTT

The gene YMR272W-B (811089..811196) is annotated in this region but switched OFF
Identified by gene-trapping, microarray-based expression analysis, and genome-wide homology searching