>Intergenic-YML117W-YML116W scer_Chr_13 (37648..38195) 548bp
TATAGCTGTGCTGAGCCTGAAGTATAATGCATATCCATCGGACTATTTAGACAAAGCCCA
AGGAAGCCTAAGGCGGCCTGCCAAGGTGTTTCTCCCTTTTTTTCTCCGATTTCTTTGTAT
AAACTAAATAATATAGTGATTACTAATGGAATGGCGGTATTATGCACCTAACCTGTTCAT
TCTGCCACAGATTACGTAAGCGATTTATTGCCGGCACTTGTTGTCTTAATGACCGAGTCA
CCAATGTGGAACGATAATTTTCTCTGACTCAAACCTGTTAATTTTTTTCTACTTCGTTTC
GTTAGCGACGACGTCAAGCCGCAGGATCCTGTCTGCCTTGACCTCTTCTCTACCTTCAGA
ACTTACACTTTTCAGGTAAGATGACCTTTATATAAAAGTTGACACTATTACAGTTGTTTA
TAAACGTCTGAAGAATGAGACGTTTTTATAAAATGAATAAAATGCATATTCTAAGTTTAA
AACAACATTTTCAAAGTGTACGATTGTAAAAAGAGAGGCAATTAGAGAATCTCAAACAGG
TAATAATA

The gene YML116W-A (37472..37774) is annotated in this region but switched OFF
Putative protein of unknown function