>Intergenic-YEL069C-YEL066W scer_Chr_5 (23232..26666) 3435bp
TTTTTTTTTTTGGTTTAACTTTTGTTTCTTTTTTCTTTTTTTGATTGTTATGCCTTACGT
GCAAAGTAGGAATAGAAATTTTACCTCAAACAACTCTGTTTCATCTGCCTCTTTTATATG
ACTTTTTAGTTGCAATTACTTGCTGGAAGATACGACCTCACACCCTTGAACGATAAATTT
CGACAAACACTATGTTCATTTGCGCATATATCCAGGGGAATCAACCCTAGAGAGTACTGT
CTTTTCATTGGGTTCTGAATATCCGTAAACCAGGAGTTAAAGGATATTATTATCTAATAT
TATCCTCGAATATCTACGTCATGCCGGGCTAGGGCGGATTCAACCTCACCATCTTGCCTA
CCTACAACCCACCGCACAAGAAAGCATCCCACGCCGCGTGGTGCCTTTGTTCCTTGGTTC
CTGAACTGATGATTATACTTTCCCCACGCACATGAAACGCATACCCCACCCCCACATTTC
TCATTTAATATTTTTTAGTTTTAACTCCGGTGCGCGCCCCTTGAAGTTAAATTAAACTAA
CTGTCTGCATAGTTCAATAAACGATGTCGACAACGATTAGGTGATTGGCTAGCCATCGCA
ACAAGCAGACATCAACTGAAACTCTAAAATGTAGTCCTACAGACAAAAAAAAATTGTTGT
TTTCAGGCTTATGTTCAAGGAAAGGAACACGACAAATGATTGTCAATAGTATGTTTCTCT
GAAGGCACAGGTTACTTTTTATTGAATGTATTTCAAACTGCCTTTAGTAAGGAAGGTGCT
TTTGCAACACTTTGCCCCTTCGTTGTGAAGCATTTGGCAGTACAGCGATAAATCCTAGAC
ATTATTAAATTGGTAAAAGGGTGCCATAGAAGGACACGACAACCAGAGCTCGTACCATTA
CTATTTTGTTCCATTCTAAAATTATAGAATTCGCGTTAAAATGTCCGGGTTTCTCAGCAC
TTCAGATTATAGACATTTTGTGAAATAGCAAATTGCAGCACGATCGGTGATTAGCAATAA
CGGTGTCCGAGTCCTTTCCCTCTCATGTTTTTTTTTCAACTACAGTAATTCTCAGCAGCT
GCAGCCTTGAAAACTATAGGTCAATGATAATATGTATTAATAACCAACTCTTGGCGCTTA
CAAAATTGATTTATTTAGTCAATTGACCCACATGGAAGGGTAAAACCGCATACAAAAATT
TCTCTTACAAAGGATCTTATGAACATATCAAATCAATTATAGAAGCCGGAAAGACTGTCA
TCCTATATAGGGTGGCAATGTTATTATCAGGAAGGGTAAATCTCATTTCTAAATTGCGGA
AGGAGCTTTGCTCTGGTTGAAATTATTATCATTATCGCTACTTCAGCGATTTCAATTTTG
CTTACTAGATACCAGCGTCAAGGTCCTATCTTTTGTTGTGTTGCTGCCTCAAACATGTCA
GTTTAAGTTTGAAGGTTGACACTGTAAAATTTACTTTGTATATTGCATTTATGGATGATT
TACAGTGTTTCAATTATGCTCTATTGAGGATAGTGCTTTTGCAGAATATTTCACTTGAGG
CCACGCATACTGGCCTAAGGCATTACATTTTGAAATAATCTTCGCATGGGGCTTGTCACA
GTCATGAAAGGGGAAATAGCTTCTAGTATCTGGCATGATATGTCCTTACAGAACTTGATC
TTTCACAGCATAAGAATTATTACATCCTAATATAGATTTCCGACACTGCAGTGAGGCAGA
TGCCAATATTGAATCGAAGTTTTGATTAAGGTATGTGAGAGTGTGATTGTTTGACATCCC
TCCAGTTGTTCGAAGATATCAACGGCGCAGGAAAGCCGCTGATAAAATGGTCGCTCCGTG
GTTGAAATTGTAGTAAATAACCACTTTTTCTTACGTAGAACTTTATCCTTTTGGCTGTGG
TTTGAAATTATTCGTTTTCTTCCCAAACGTTGCAGGGAAATAAGAAAAAAGAAGGAGAAA
TAATACCTGACAACGTAGCAGCGAGCCTTAGTTCATCTGCTCAGGTTGAAAAACATTGAT
CTTGAGCATTTTCATCTTGCGCTTTAAATCTCTTGGAGTATAATTAAGAGCAAATTGTAA
CAGTATTATGACATTTGCAGGACTCACACCCAGAAGTCCTTTCCACCACTTCAGTACTGT
AACTTGAAAAAAAAAGGGAGAGAATTGATCTAATTAAAATTATATAGTTATTCAAATTGG
AAGTAAATAAATAAGGACTGCCGGCCCATTTTTCTTTTTTTTCTCTTAACTGACCTGATA
TTTTTGAAACACTTAACGCCGTTTTCTTCAATTAAATCAGAAGTGCAATTAGTGGTGCTA
TGTTAACATATGTTTGAGAGCCTACTAAATGTTAGAGTGGACAGTTCTTGCTTACAATGA
TTAAGAATTGATGGCTAGTAATGTGGGCGGTCGCATCTCGCTTGTCTAAGGATGGAGTTC
CTAAATTCTTCACGATCGGGAACAGGTCCTTTGTCCCAACTTGCCAGTTTATCGTCAACG
AGTTTATCAATCTCGTCGTAGTGGATAGTAATCCATGGATGATCTTCATTACCGCAAGTA
GTCCAATTCACTGGTGGTAGTTTTACGCTCCAAAATCTCTTATCATAATCCGCTATGCGG
TAAAATGTCGATGTATTATGCGTAAAATTGTTATAATTGTCTGTTGTATCCGTACAGCAT
ACCAATGCCAAGCCTTGAAAGGCGACGGCTAGTGCCAAAATTTTCATCCTTTCAGTATAC
CTGATTTTGGCTTTATCCTTTCAATGTGCCTGATTTTGGCTTTCTCGTATCTTTCGCCTG
ATAATATGAAAAAGTATATACTGTGAAAAAACAACCGTTGGAGAGCTACGACCGACTGAA
AAGATAAAAATGCTTGAGTTTTTCAGGTTAGCATGCCGTCTAGTAGAATTAAACCATTGT
AGTTCTTCACTTTTGTATTAAACGTAGGATTGAGGCGGTGGCTGCTTTTGGTTTACTATG
CGTTGTAAGGGGATGGGGAAATGGAACGTCCAGAAGAAAGTTATAGTTCCCGTTTGCATA
ACAGCAGAGACAAAAATGGTCGAGCACTTCCGTGTTGACTGTATATCTGTGCATGGTTGA
CTAATTGTTGTTTGATGGCCTGAAGTTCTTGTCACACTCTGCAAATTATCCCGACATTCA
GACGTACACGTACAAAACACGAATGCTACTCTAGCATATCCAATCGATCGCACTGAAGCG
ATCAGCTGATGATCAGGCGGTACATTGCATACTCTGCGTAAGGCCTTTTTCACCAATTGA
CCGCATCGTATATTTCCCAATCCGGTTATTAAATCGTTATCAGGCGGAAACCTTCGCGAA
CAGTATACTGGAGAGTGTTGCGACAAGATATTTAAAAGCGGAAAACGGGCATATAAAATA
GATGAGTGCAGACTA

The gene YEL067C complement(26189..26776) is annotated in this region but switched OFF
Putative protein of unknown function; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies

The gene YEL068C complement(25646..25978) is annotated in this region but switched OFF
Protein of unknown function; expressed at both mRNA and protein levels