>Intergenic-YEL059C-A-YEL058W scer_Chr_5 (42625..43251) 627bp
GAGGGTTGATTGTCTTATCTGCGATAGATGAGTCTTTCTTTCCTTCTCTTTTCCCCTTTT
CTCCCCCCCTGTTTCTCGTCCATCTCTATCTGTCTATCTGTCTTATCTACTGTTAGTTTT
TTTTTCGCTTTCACGATACCGCATTACGTACTGCGCTGCGGAAGTGTGGATGAGTGGCAT
ATACACTCTTCTGCAGAGGATTTTCGTACACAACGGTGTGTGTGTGCTGTGAAGCTGTCT
GCTTCCTTACTTGGCTGTTTGCTTGCTTGTGCGTCATGGTCACTTTTGTTAGAAGTGAGC
CGCATAAAATGGCATGTCGGCACAGCCTACAGTTAAAAATTAAGCATATCTGACTGTTTA
TCTGTTTATCTGTTTATACACGGTGAACTGTCACGAGAACCCTTACTTGCACGATTAGCA
GATTGTTCAGAGAGCCTCGCTCGTTGAAGTTCTTCTATATGCCAGCGTGTTTCATGTAGC
AGGAAACGTTGCTCTATTTATATCTTTTCTGACATTTTGCGTCGTCGGGAAAAAAAAGAT
TAAGTAAGAACAAAAAACCGTTAATGGTTTCAGCAATCGAGACAAGTACAAGGACCAAGG
CAAAGGTCAGCAGTAAGCTTAGAGACG

The gene YEL059W (42652..42960) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a functional protein; mutant is hypersensitive to hygromycin B indicative of defects in vacuolar trafficking