>Intergenic-YDR365C-YDR367W scer_Chr_4 (1206384..1212847) 6464bp
CTTCAATTTTTCTTGCAACCTTATACGATCCGCTGAAATGTCTTGAAAAATATTCCGGAC
CCACAGTTATGTGATATTTATTATTTGTACCATTATGCTAATGATGAATTTGAGATGAGA
TGAGATGAAATTTTTTCTGTAACTGAAAAATTTCGGAACGTCAATAATGATCGGTAGCCT
CATCTGGGATATTTGGCCCGGCTCATATTGCTAATCTTTGGATATAGGGCTATTAGCAGA
TTTCAATCGTCCTCTCTTGGCATAGTAGACACAGAGTTGTATTTGCGCTTCTGAGCGATG
CTTCCGAGATTGTTGAAGCATGTTGGAATAGAAATCAACTATCATCTACTAACTAGTATT
TACATTACTAGTATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAG
TCATCTAAATTAGTGGAAGCTGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATA
TAAACATATAAAATGATGATAATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTT
TTATGGATTCCTAAATCCTTGAGGAGAACTTCTAGTATATTCTGTATACCTAATATTATA
GCCTTTATCAACAATGGAATCCCAACAATTATCTCAACATTCACCCATTTCTCATGGTAG
CGCCTGTGCTTCGGTTACTTCTAAGGAAGTCCACACAAATCAAGATCCGTTAGACGTTTC
AGCTTCCAAAACAGAAGAATGTGAGAAGGCTTCCACTAAGGCTAACTCTCAACAGACAAC
AACACCTGCTTCATCAGCTGTTCCAGAGAACCCCCATCATGCCTCTCCTCAACCTGCTTC
AGTACCACCTCCACAGAATGGGCCGTACCCACAGCAGTGCATGATGACCCAAAACCAAGC
CAATCCATCTGGTTGGTCATTTTACGGACACCCATCTATGATTCCGTATACACCTTATCA
AATGTCGCCTATGTACTTTCCACCTGGGCCACAATCACAGTTTCCGCAGTATCCATCATC
AGTTGGAACGCCTCTGAGCACTCCATCACCTGAGTCAGGTAATACATTTACTGATTCATC
CTCAGCGGACTCTGATATGACATCCACTAAAAAATATGTCAGACCACCACCAATGTTAAC
CTCACCTAATGACTTTCCAAATTGGGTTAAAACATACATCAAATTTTTACAAAACTCGAA
TCTCGGTGGTATTATTCCGACAGTAAACGGAAAACCCGTACGTCAGATCACTGATGATGA
ACTCACCTTCTTGTATAACACTTTTCAAATATTTGCTCCCTCTCAATTCCTACCTACCTG
GGTCAAAGACATCCTATCCGTTGATTATACGGATATCATGAAAATTCTTTCCAAAAGTAT
TGAAAAAATGCAATCTGATACCCAAGAGGCAAACGACATTGTGACCCTGGCAAATTTGCA
ATATAATGGCAGTACACCTGCAGATGCATTTGAAACAAAAGTCACAAACATTATCGACAG
ACTGAACAATAATGGCATTCATATCAATAACAAGGTCGCATGCCAATTAATTATGAGAGG
TCTATCTGGCGAATATAAATTTTTACGCTACACACGTCATCGACATCTAAATATGACAGT
CGCTGAACTGTTCTTAGATATCCATGCTATTTATGAAGAACAACAGGGATCGAGAAACAG
CAAACCTAATTACAGGAGAAATCTGAGTGATGAGAAGAATGATTCTCGCAGCTATACGAA
TACAACCAAACCCAAAGTTATAGCTCGGAATCCTCAAAAAACAAATAATTCGAAATCGAA
AACAGCCAGGGCTCACAATGTATCCACATCTAATAACTCTCCCAGCACGGACAACGATTC
CATCAGTAAATCAACTACTGAACCGATTCAATTGAACAATAAGCACGACCTTCACCTTAG
GCCAGGAACTTACTGAATCTACGGTAAATCACACTAATCATTCTGATGATGAACTCCCTG
GACACCTCCTTCTCGATTCAGGAGCATCACGAACCCTTATAAGATCTGCTCATCACATAC
ACTCAGCATCATCTAATCCTGACATAAACGTAGTTGATGCTCAAAAAAGAAATATACCAA
TTAACGCTATTGGTGACCTACAATTTCACTTCCAGGACAACACCAAAACATCAATAAAGG
TATTGCACACTCCTAACATAGCCTATGACTTACTCAGTTTGAATGAATTGGCTGCAGTAG
ATATCACAGCATGCTTTACCAAAAACGTCTTAGAACGATCTGACGGCACTGTACTTGCAC
CTATCGTACAATATGGAGACTTTTACTGGGTATCTAAAAGGTACTTGCTTCCATCAAATA
TCTCCGTACCCACCATCAATAATGTCCATACAAGTGAAAGTACACGCAAATATCCTTATC
CTTTCATTCATCGAATGCTTGCGCATGCCAATGCACAGACAATTCGATACTCACTTAAAA
ATAACACCATCACGTATTTTAACGAATCAGATGTCGACTGGTCTAGTGCTATTGACTATC
AATGTCCTGATTGTTTAATCGGCAAAAGCACCAAACACAGACATATCAAAGGTTCACGAC
TAAAATACCAAAATTCATACGAACCCTTTCAATACCTACATACTGACATATTTGGTCCAG
TTCACAACCTACCAAATAGTGCACCATCCTATTTCATCTCATTTACTGATGAGACAACAA
AATTCCGTTGGGTTTATCCATTACACGACCGTCGCGAGGACTCTATCCTCGATGTTTTTA
CTACGATACTAGCTTTTATTAAGAACCAGTTTCAGGCCAGTGTCTTGGTTATACAAATGG
ACCGTGGTTCTGAGTATACTAACAGAACTCTCCATAAATTCCTTGAAAAAAATGGTATAA
CTCCATGCTATACAACCACAGCGGATTCCCGAGCACATGGAGTCGCTGAACGGCTAAACC
GTACCTTATTAGATGACTGCCGTACTCAACTGCAATGTAGTGGTTTACCGAACTATTTAT
GGTTCTCTGCAATCGAATTTTCTACTATTGTGAGAAATTCACTAGCTTCACCTAAAAGCA
AAAAATCTGCAAGACAACATGCTGGCTTGGCAGGACTTGATATCAGTACTTTGTTACCTT
TCGGTCAACCTGTTATCGTCAATGATCACAACCCTAACTCCAAAATACATCCTCGTGGCA
TCCCAGGCTACGCTCTACATCCGTCTCGAAACTCTTATGGATATATCATCTATCTTCCAT
CCTTAAAGAAGACAGTAGATACAACTAACTATGTTATTCTTCAGGGCAAGGAATCCAGAT
TAGATCAATTCAATTACGACGCACTCACTTTCGATGAAGACTTAAACCGTTTAACTGCTT
CATATCATTCGTTCATTGCGTCAAATGAGATCCAAGAATCCAATGATCTTAACATAGAAT
CTGACCATGACTTCCAATCCGACATTGAACTACATCCTGAGCAACCGAGAAATGTCCTTT
CAAAAGCTGTGAGTCCAACCGATTCCACACCTCCGTCAACTCATACTGAAGATTCGAAAC
GTGTTTCTAAAACCAATATTCGCGCACCCAGAGAAGTTGACCCCAACATATCTGAATCTA
ATATTCTTCCATCAAAGAAGAGATCTAGCACCCCCCAAATTTCCAATATCGAGAGTACCG
GTTCGGGTGGTATGCATAAATTAAATGTTCCTTTACTTGCTCCCATGTCCCAATCTAACA
CACATGAGTCGTCGCACGCCAGTAAATCTAAAGATTTCAGACACTCAGACTCGTACAGTG
AAAATGAGACTAATCATACAAACGTACCAATATCCAGTACGGGTGGTACCAACAACAAAA
CTGTTCCGCAGATAAGTGACCAAGAGACTGAGAAAAGGATTATACACCGTTCACCTTCAA
TCGATGCTTCTCCACCGGAAAATAATTCATCGCACAATATTGTTCCTATCAAAACGCCAA
CTACTGTTTCTGAACAGAATACCGAGGAATCTATCATCGCTGATCTCCCACTCCCTGATC
TACCTCCAGAATCTCCTACCGAATTCCCTGACCCATTTAAAGAACTCCCACCGATAAATT
CTCGTCAAACTAATTCCAGTTTGGGTGGTATTGGTGACTCTAATGCCTATACTACTATCA
ACAGTAAGAAAAGATCATTAGAAGATAATGAAACTGAAATTAAGGTATCACGAGACACAT
GGAATACTAAGAATATGCGTAGTTTAGAACCTCCGAGATCGAAGAAACGAATTCACCTGA
TTGCAGCTGTAAAAGCAGTAAAATCAATCAAACCAATACGGACAACCTTACGATACGATG
AGGCAATCACCTATAATAAAGATATTAAAGAAAAAGAAAAATATATCGAGGCATACCACA
AAGAAGTCAATCAACTGTTGAAGATGAAAACTTGGGACACTGACGAATATTATGACAGAA
AAGAAATAGACCCTAAAAGAGTAATAAACTCAATGTTTATCTTCAACAAGAAACGTGACG
GTACTCATAAAGCTAGATTTGTTGCAAGAGGTGATATTCAGCATCCTGACACTTACGACT
CAGGCATGCAATCCAATACCGTACATCACTATGCATTAATGACATCCCTGTCACTTGCAT
TAGACAATAACTACTATATTACACAATTAGACATATCTTCGGCATATTTGTATGCAGACA
TCAAAGAAGAATTATACATAAGACCTCCACCACATTTAGGAATGAATGATAAGTTGATAC
GTTTGAAGAAATCACTTTATGGATTGAAACAAAGTGGAGCGAACTGGTACGAAACTATCA
AATCATACCTGATACAACAATGTGGTATGGAAGAAGTTCGTGGATGGTCATGCGTATTTA
AAAACAGTCAAGTGACAATTTGTTTATTCGTAGATGATATGGTATTGTTTAGCAAAAATC
TAAATTCAAACAAAAGAATTATAGAGAAGCTTAAGATGCAATACGACACCAAGATTATAA
ATCTAGGCGAAAGTGATGAGGAAATTCAATATGACATACTTGGCTTAGAAATCAAATATC
AAAGAGGTAAATACATGAAATTAGGTATGGAAAACTCATTAACTGAGAAAATACCCAAAT
TAAACGTACCTTTGAATCCAAAAGGAAGAAAACTTAGCGCTCCAGGTCAACCAGGTCTTT
ATATAGACCAGGATGAACTAGAAATAGATGAAGATGAATACAAAGAGAAGGTACATGAAA
TGCAAAAGTTGATTGGTCTAGCTTCATATGTTGGATATAAATTTAGATTTGACTTACTAT
ACTACATCAACACACTTGCTCAACATATACTATTCCCCTCTAGGCAAGTTTTAGACATGA
CATATGAGTTAATACAATTCATGTGGGACACTAGAGATAAACAATTAATATGGCACAAAA
ACAAACCTACCAAGCCAGATAATAAACTAGTCGCAATAAGCGATGCTTCATATGGTAACC
AACCATATTACAAGTCACAAATTGGTAACATTTTCCTACTCAACGGAAAAGTGATTGGAG
GAAAGTCGACAAAGGCTTCGTTAACATGCACTTCAACTACAGAAGCAGAAATACACGCAG
TCAGTGAAGCTATACCGCTATTGAATAACCTCAGTCACCTTGTGCAAGAACTTAACAAGA
AACCAATTATTAAAGGCTTACTTACTGATAGTAGATCAACGATCAGTATAATTAAGTCTA
CAAATGAAGAGAAATTTAGAAACAGATTTTTTGGCACAAAGGCAATGAGACTTAGAGATG
AAGTATCAGGTAATAATTTATACGTATACTACATCGAGACCAAGAAGAACATTGCTGATG
TGATGACAAAACCTCTTCCGATAAAAACATTTAAACTATTAACTAACAAATGGATTCATT
AGATCTATTACATTATGGGTGGTATGTTGGAATAGAAATCAACTATCATCTACTAACTAG
TATTTACATTACTAGTATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAA
ATAGTCATCTAAATTAGTGGAAGCTGAAACGCAAGGATTGATAATGTAATAGGATCAATG
AATATAAACATATAAAATGATGATAATAATATTTATAGAATTGTGTAGAATTGCAGATTC
CCTTTTATGGATTCCTAAATCCTTGAGGAGAACTTCTAGTATATTCTGTATACCTAATAT
TATAGCCTTTATCAACAATGGAATCCCAACAATTATCTCAACATTCACATATTTCTCAAA
GCATATATGTAGTATATATACATATACATATATATATTTATATAGGTTTGGGAACCTATG
TTTTTTATTGTACCAAACGCATCCCTCTTCAATAATCTTCGAAAAAAAAGTGCACAACAA
GCGGGAAAATCTGTGTAAAGCTGTATAAGTGATCTGTACAAAAACTACGAAGAAAAGAAA
TAATACCAGGGAGGAACTACCAATTGTAACCATTAACCTTAGTT

The gene YDR366C complement(1212438..1212836) is annotated in this region but switched OFF
Putative protein of unknown function