>Intergenic-YDR119W-YDR118W scer_Chr_4 complement(687841..688226) 386bp
CTCTACTTAACCGACGTCAATTACCTTGAAAATGTAAAAAAAAAGTAATCAAAAGTAGCA
AAAATCTGAGTAAACTGACACTTCGGCTATTCTATATAGTATATCAGCTAAATTATCTTA
AGATAAGCAATAAAAAGTGAGATAACGATGAAAAAAAAAAAAAAGACTTGACACAATTGA
CTCCATTTTGAGATTGCGGGCCCTTGAAATTTTTTTTTTTTCTCAGTACACCACAGGCGG
GTTCCAAACTTCTTCATAGTGCGCCATACAAAAGAAAAGTCTTGGGAGATGATGCATACG
CTATTTACGCTTACATTTCATTACTACTATTATTGGTGATCATTATGCAAATACTAAAAA
AAAGCTACTCGTCATCTGTCTATGTG

The gene YDR118W-A (687768..687884) is annotated in this region but switched OFF
Dubious open reading frame; identified using a combination of expression profiling and mass spectrometry