>Intergenic-YDR113C-YDR115W scer_Chr_4 (681618..682174) 557bp
AAAGGTTTATTATCTAGCACTTAATCTAGCTTGGTACCGCAGAAGTGTAATAGTATGTGA
ATGGGAAAAACCGCTAGCAACCGTTACTTGCCTTCGCCGAATATTGATTTAAAGCTGCAT
TTATTTTGTTTGTTTATTTTGTTTGTTTTTCTTTTTGACCTCTTACACGAGTTTTTTGAC
GCGTTTGAGATCTTTGTGTGAAAACGATAAGCAACCTACGCTAACAAATACACACGTCGC
ACGGAAAGTGATAGTGAAGCAGATATTTCTCGCAAATCCTATGTTATCCGTAAAATAAAT
CCAACCCTAAAGTATTAACATGTAACAACTTAAGCGCTTCCTTAAGACTGTATAGATATA
TATATATACATATATATACATAATCATGAAACGCATCGTCGAAAGGTCATTTGAAGCTCG
GATCACGTGATCGAAAGCTGTAAGGAATTTGAAAAGCCAATTTTCCCGTAGAAGCTGTGA
GGTACAACAAGTGAAATAACTACAGGAGAAACTCACTGAGAAACGTTGGAATAGAACAGT
AGTAATCGCAGGACGGA

The gene YDR114C complement(681924..682226) is annotated in this region but switched OFF
Putative protein of unknown function; deletion mutant exhibits poor growth at elevated pH and calcium