>Intergenic-YDL164C-YDL161W scer_Chr_4 (167255..167713) 459bp
GTAATTGATGAACAATGACGTTAAAAGCTGCTCTAAACCTCCAAAATCATTACTTTTATT
TTTGAACAAAGTACAGCGAGATGCAAACGCATGGCTTATTGCAGCTAAATTTCACTTTCA
CGCGTTTTCGCGTTAAGGTGAAAAATTCCATCAGCCATCTCAAGTGGAGGAACACATCGA
AGCGAGCAAAAAGATGACAGAGTTAAACAGCAATAGAACCAGCGGCTGCAGTACGAATTC
CTATTGCAAGTCTTACGGAAGGTTGGTGGGGCCTTATGTTGTTCAAAGTACTTGATTTTG
GAAGTATGGTTGTCTGAAATTGTGGCTACGTATAGAGAATCATCCGGGTAATGATGAAAG
TTTCTTTCAATGACAAATAGGAGTTTTAAGAAGTAGAAGAAAGAGCCGTTCGTATGAGTG
CCAGGATCAGAAGGAAAGGGAGCAAGAGGCAGAACAATC

The gene YDL162C complement(167359..167715) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps ENT1/YDL161W, a verified gene involved in endocytosis and actin cortical patch assembly

The gene YDL163W (166956..167258) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on experimental and comparative sequence data; partially overlaps the verified gene CDC9/YDL164C encoding DNA ligase