>Intergenic-YDL010W-YDL012C scer_Chr_4 complement(431518..432329) 812bp
AATAAAATTGTTTCTATATTAAACCGCTAGGTTGCTAAGGTTTCGTCTTTTCTATCTTAC
GATAATTTGCTTAAAAGTTCATTTAGAGAATAGATAGTGATCTTTCCCAGTATAATGTTT
TCCCGATTTCGCGAACGCTCCGCCTCAGGCGCCCCGGGACGCGTCATGCGCGTTCCAGAA
AGTTAACTAACTGCTAGTGCATTCAATTTCTCAAGGCGTAGTATTTGGGATCTATAAAGC
CTTCGACATTAAGCACTATGCTTAAAAGCGAACAGCCTGCGCCACTACTTAAGAGCGAAT
CTTGTGTGGAGGGATGACTAGGTCCAAAGAGGGAGAAAAGGATCTTGCGGAAAAGTCAAC
AACACTAATCGGTAGCTGAGTCTGTCAGTGCATCCTTACTGGCTTACTATTTTCATTCAT
GCTGCAAGTAGATTATCCTCTAGTTAAATTAAACGCGGATGAACTACGCCATTAAATCCA
TCATAAGAAACTAATTACTACTTTTAGGAAATTAGCCAACTAAAAACTGCTGAAACGCCA
CATTTCACATAAAACCCCACGGAGCAGTAATGGGAGATCTTAAGCTCAGCCCAGTACATA
TGTCCATCAGCCTTGAATAGCCACGGTGAGTTCTCGAAGCTTCCTTCCACCTAGTCCAGA
ATATTTCTTGGTAAATGGCTCGAAGTTTTCGTATTAAACGATGCTATCAGCGGCATCGTG
AAATATTGAAATATAAAAAGTATTTACGCAACCGAAAAGGATATTAAGACAAACCCATAC
AATAGCCCATAAACCAAGCAAATACACATCTC

The gene YDL011C complement(432308..432631) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; overlaps the uncharacterized ORF YDL010W