>Intergenic-YDL008W-YDL010W scer_Chr_4 complement(433026..433496) 471bp
ATTTTTATAATCTGTATTGCCACTTTGCTTGTTAAACTCTCCCGATATTGTACAAAGTTT
TTGAAGAATGCATTATTTTTTTATCTGCAGACACGGAAGATACAAAAGTTATCTCGGCAG
CTTACCCTTTATATCGAATGCAGGCGTAGACAAAAGTGCGTTGCATAACTTACCAAGGTG
AAGTGCATGGACCAGCAAAGGATAGAAGTTATTGTAAACATCGAAACCATAAACTTATAT
ATGTATATATGAAGGCATTAAGCGTTTTATGTTTTCACAACCCTTTTAAGAGATGTCTTG
GACAAAAAAGCTTCTTCGTTGGTGATAGCTTCTTTATTCCAACTCCGAAACGCCTTGTGC
TAGGAAAACTACGCCTTTCCAACTACACTGCATTTCACGACCTAATCATTCACGACCTCT
TTATTTATATATTTATTCTTAATTTTTTCTTCTTTCCTTTTTGTAACAATT

The gene YDL009C complement(432925..433248) is annotated in this region but switched OFF
Protein of unknown function; mRNA identified as translated by ribosome profiling data; partially overlaps the verified ORF YDL010W; YDL009C is not an essential gene