>Intergenic-Suva_2.601-Suva_2.599 suva_Chr_2 complement(1070547..1072119) 1573bp
TAAATAGTGTTCTTTATAATGAATCAATAGCGTATTACTATACTTTCATACGAATTGGAT
GGCACATAACGATGGCCCTTAAGGAGAGGAAAGGTTCAGTGGGACAGGTCTGGTTCTGAC
TCTTCGTGATGGTCACCATGTGGTGGGCAGGCTAAACAGAAAATAGATTGCCGTTGAAGC
CAAGAATGAGAGGACTGCACAGAATAGGGCAGCCCAACAGGCGTTTCGAAACAGGAAAGA
AGACAAATGGAAGCAGCTGGAGGAGAAGACCGAATTGCTGGAGTCAAGGGATGCCCAGAG
CAAGGTCGCAACAGACTATCTACAAGGCTCTTTGAGGAGCTTACTATTGGAAAATGACAA
GGTATAGAGCTCGGAATGCGGATGACTCCATCCTGGATGGCTTACAGAAACAGCAGGGGG
AAACAAGAAGATGGGGAGTTGCAAATGGGGAAGACCAAGGATACCCGTGATGGTCAATAA
CAGCACTAAAGAACCGCCATCACCCAGTTCAAGCGGGAGCCTTGCTGCCAACACGAACAC
GGAAGCAGAAGCGTGTATGCAGGAAATCAGGATTGCCGCCTGGAGCCTGTGAATGGATTC
CGATTGCAATTCAAATTTCATTACGAATGATAGCATCCCTGACTTAAAGAATACGTGGGC
ATCTCCCCTTGGAAGTCAAAAATGTACCATCAATAAGGCACTAATGGTAGTGATACGCTT
TTCTTTTGGTCTCAAGTTTGCACTCAACAACGGATAAACGGATATAGAAGAGTTGGAGTA
CGACTTACAACCTCGTACTGCTGAGGTTTTTGAAGGTTTTCAGTCCAAGGGCGTACGGTC
GTTAGCATTTTCCGACAAAATAGACCAAGAGTATCTTCTTAATGACGCTAGCAACGATCT
CTTGTCAGCTAACCAAACGCCCATTAGTCTCAAGTGCAATTGCAACGGTAAGTGCATGAA
AGCCATACCTTGCCCGATAAAAAGATTAAATATGGGCTAATAACAAGACACCTGATAAAC
CAGGAGCCTCTGGATTCTATACTACCAGCATCTGCCCCCCGTGGAGGGGTTCTGAAACTC
CATCCGGAACCATAGTTCACATCAAAAATGCCATATTGAAACGAAACTTTTTTTTGCTCC
CACATCTTAAGACACATCTCTTCTATACCTAAACATTCTTCTTTAGACATCGACAATTTA
TGCTGCGAATTAATGGTCAAGGCGAAATGTTCCGGTGACTGCCAGATCATGGTACAAGCG
CATGGCCTACAATCTGTGCTGGCCAGACAACTCTTATAATGCACACGAAACATAATATAA
TTATATATAGTTTTCTGTAAAGAGTTGGTATGTTCGTCACATGCTACGAAATGCAGACCC
TTTCAACTTGATCATTTTTTTTCCCCATTGTTATAACGACATAATAGAGGTAATTTATTT
ACAATAGTATATCGGATTAAAGCAATAGCTGCGCAAAACAAAGTGCGTTTCCGAGTGTTT
TTTCTTTTCATTCTTATCTTGTAGACCAATCTAGTGGAAAACTGAACCATCGTTTCAAAA
AGTTGCTGCCATC

The gene Suva_2.600 complement(1070824..1071000,1071004..1071024,1071028..1071144,1071132..1071362,1071366..1071527,1071531..1071734,1071738..1071752,1071756..1071953,1071957..1071977) is annotated in this region but switched OFF
YDR423C (PSEUDO)