>Intergenic-Smik_5.19-Smik_5.21 smik_Chr_5 (26806..29108) 2303bp
CTTTTAGTTTTTATTGCGCTTTTGTTTTTTGTTTTTTGTTGTTTTAGTTTTGTTATCCTT
TATTCTTCTAGGGTACAAGTGTACGATGAACCAGAACCAGTTAATTTCACCTTTGCCCTT
TATATGTCTCTGTAAGTGGCAGGTTTCTAGGGGGAGGCGACAGTCTCACACCATTGATGC
GATAAATTTCAATAATGAATACGTTTGCTTTTTGCATATATCCAGGGGAATTCAACTCTA
AATATTACTTCCGTTTCATTGGATTCTGTATCCTATAAGACTAGGAGTCAAGAAATGATA
TTATTCAATAATATTCTAGAATGTCTACGTCATGTCTGACTAGGCAGCTTCCTGCCTCAC
TAACCTGCCTGCTGACAAACTACCGCACCGAGGAATCACCCCACTTTATATTGTGCCTTA
GTGCCTCGGTGCCTGCACAGATTCTTTTCTATAACCCACGTAGTCGAGACGCATACCCCA
CCCCCATCTTTGATATTTACAAACTTTAATTTTTAAGTCCGGTACGCGGCCCTTGAAGTT
AAACTAAATTAACTGACTGCATAATCCTGCAAATAATGTCATCAGCAAATACCCAATTGG
CGAAAAAAGTACATGCTTTTACCCAAGTTATCGTCGACCTACTCATGGGTTACCAAATGG
ACGTTCGCTATACCCCTTCCAAGAAAAGCTAGAATCTCAGATAACAATAAACAAGCAGTA
TTATATTTGACTGCTTTGGTGGCACCATATCTTTCTGGACAAAAGGTACGATTGTAGCAA
CTTCTAGGCCTTCACTAAAATTTTTGGTTGTTCTTTGAAATCATACAGTTGCGAACAAGG
ATAAGGGAGACGAAATACTAAAAAACGTGAGGCCCTTGTCTCTATTTCGCCTACATAAAC
TACAAAATCAACTACGCATCGTCAAGTCGTAGTATAAATATTTTGTAGTATAGTTCATAG
TGGATTGTGAAGCTACTTCCACGTTTTCGAGACTGTACTCTGGGCACGTTTCATCACTTG
CATAACTGCATTGATGAATTAATACATTATTGACATTATGAACATATTTAAGCTGTAAAT
AAGCATGCCTGTTTGCTCGCTTTTCTTTTCTCTTTTCACAGTCTCATTTTCTTGTAGCGT
GTAATTCAGTCTTTTTCAGTTGAGTTAAAAATGCGACTTTTAGTGTTCCATTGACATGCG
CGTATATCTTAGGTAAATGCTGCGCAATCATGCCTCTGTTTATTTGCATTAGTAATCTAC
GGCTGGTGGTGGGGGCGGTTGCATCTCGCTTGCCAGAGATGATACGCTTCCTCAATTTTT
CACGATCTGGGGCAGGCCCATTGTTCCAATGAGCCAGTCTATCGTCAATGAATCTATCAA
TTTCATCATAATTGATAGTAATCCAAGGATGGTCTTCATAGCAGCAACTCGTCCGATTTA
TTGATGCTGTTCAACTGTCCAAAATCTGAGATCATAGTCAGCCAGATGAAACGATGCGAA
TGTATTTTCTGCAAGATCCTTATCATTGTGAGTTGTTTTTCTGCAGCAAGCCCATGCCAA
GCCTTGAAGAGGGACAATTAGTGCGAGAAGCCTCATTGATTTCGTATATTGGCTTGGTTT
TATGGCTCTGTATTTCTTCCTCTTACTTCGGCTTCTTATAAATGAAAAAGAGAATACAAC
GAACTAACAAGAGCTAACGATGCTAGATTTCCAGTACACTGCCCTCTCTATCAAAAACAG
TTAGTTGTAGGTGCTTGTTCAGTATTAAGCGTATGGTGGAGGCACGTGGCTGCTTCCAAG
CCACCATGCCTTGAAAGAGGGAGAGAATCGTCAGCACTTATTCATAGATCTTCCTCGCAT
GACAGCAGAGACGACGGCCACCAACCACGCATCATAATATTGACTGTGCATCTATGCATG
ATCAATCTGAAAGGTTCATGAACACATCACAAACTTTTCAAGCTATTCCAGCATAGAAAT
GCTGACATCCGTATACCTAAAGGTCAACGCCATTATTCCAGCACGTCAACCACATCAATT
CGATCGATTAAACTAAAGACACCAGCTGGTGACCTGGCGGCATATTGATCGATGTGCGAA
AGGCATTTTTCGCAGACTGGATGTTTGGTATATTTCCCAATTTGGCTATTAAAATCGTTA
TCAAGCGAAAAGTTGCGCGACGACATATAAAAAAAGGAAGGAATGCATATAAGACAAATG
AGTGCGCTCCAGTGAAAGAAACCCACAAGCTCACCTCCATCTTCTGGTTTTTCATAAGGA
ACGTTAGCACGGAGTACACAGAC

The gene Smik_5.20 complement(28071..28103,28091..28246,28255..28401) is annotated in this region but switched OFF
YEL068C (HSP)