>Intergenic-Skud_12.148-Skud_12.150 skud_Chr_12 (274797..275804) 1008bp
CTACCAAGAGGCCAAAGTCCTTCAGCGTTTGGTGATGGGTGTTTTCCCTGAGCAGAATGC
CTAAAATATATGCTTGAAGACTTTCTCATGGCATCTACGGACCCGATTCCAAGTACCGTC
TTGAGGATGATTATAAGCTGAACACAACGTCCGTGGCATGGTTGTTCCGTTAATCCGCAA
ATCTCAATGCTTATCTATGTTAAGTTCACAAACAATCAGACAGTACAGGGCCTCATTGTA
CGCGTGGTGCGCAAGAGTTTACCGATAGCGCACAGTGCTGCCTTCTATCTATCGCAATAT
AGTTTTATATTTGGGTTGAGTGCAGTAAAAAAGAAAATAAAAGTAATTCTTTATTCCTGG
TATCATCACGGTCAGTCAATTTGGCTCCACAAGATGAAGACCATCAGATGACAGAACTTG
TGCCTTGCTAGAACAATTATGCTGTATAATTTGCTTGAAATTGCTCTTTAGAAAATAACC
TTCGTGAAGTTCATGCATTATGTACGTATTTCTCCATGAGGCAGGTTTCACAGTTATTTT
CTACGTACAACCATCTTTTTGCACCCCTCCATAAACGTCCACGCTTGCTACGGACAATAA
TTCGTGTGTCCCAAATCAGAGCTGTGGAATTTTATTCTACTTATAGGTAAGTTTGATATC
TTATGGTGCCCTCGGTATTCAATTTCTTTTACCTTCAATTAGTCAATGTTTACATTAGCG
AAAAGCGTATTCACAAGACTTTTACAATTATGATTTAGATCTGCTTACTTTATATGAACC
TTTTTCATTTGAAAAAATGGCTTCCCTCCAGCTCCTGACTAAATTGCTGAATTTGATGGA
GAACAATATCCACTACAGACAAAAATATCATTAAGTTTATACTTACCAGTGTCGTTAACC
ATTACGAACAATTCATTTGTATGTTTCTCTCCCTAATCTTTTATGATGATATCAAATACA
ATCCAGAGGAGTATCTGTGCTAAGACGACGCAATAATTGTATAACTGG

The gene Skud_12.149 (274795..274836) is annotated in this region but switched OFF
YDR343C (HSP)