>Intergenic-Kwal_56.23747-Kwal_YGOB_YDR119W-A kwal_s_56 (689246..689534) 289bp
ACTTTACAGTGAACTTTACAGTGAACTTTAATAGTGGTTTTGGTCCTGAGAACTGCCCAA
AAGACGTTCCTGCGACGGAGCCGTTTATAATGACATCAACTCTGATGCTCCAATGCCAGC
TCTGTCCGTCAAAGGCCAAACCATCGTTCACCACCCAGCTAGGCCCAGTACGGCAGCACC
CGAATCGACCAACCAGTCCTTCTTTTCCTTTGTTATATTATCATTCATTACTAATACATC
GTTACTTAGCGAATATTAAATTCTGTGCAGTGTGCGTCGTCCCATCTTT

The gene Kwal_56.23748 (689335..689538) is annotated in this region but switched OFF
[contig 173] FULL