>Intergenic-Kwal_55.20380-Kwal_YGOB_ADL119W kwal_s_55 complement(378331..379748) 1418bp
TTTCCCGTCGATACTGGGTAGTAATAGCGGGGCTACGCCTTGTGCGTTGATATCGAATGT
AGCTGTTGGCGGGTTGGTGACAAATTTTCAGAATTTACTCGCTTGATACGGATATTGAGA
GTCACGTTTTGGTAATTTCGATGATTTGATATGAGATTTGGCAATGCTTGGAAGGTGTTT
GGTGACTGATGTGATTCATGTGTTGTTCCTTGTAGAGTTTTTTTCGGGCTACTGCTCCTT
TTTTTTTTGCCTGGGTTGTTCGTCTTTTCTTGAATTGCCTTTGCATGTGTTATTCTCCTG
GCACTCACATCTGGCTTTCTGAAAGTAGCGGTAGTATATGACCCAACATCCAAATTCTGA
TACGCAGTTTAGTTCCGCTGTAAGATAGCTGGATTTGTCCCACGGCAGACCATTTTCGTT
CCAAGAAAGGAAAATCGATAAGTGCTCTTAACTTTGGAAAGGAGAATGAGCTGGATTTCC
TCTACGTTGCGAAACCATAATCACATACACTTGTCTAACTCATTCGTTTTATGATGATAT
CAAACCCATCTCTTTAAACTGACTTTAATCCATTGACTTGACTAGTTGTGTTTCCGTACA
TGATGATGTTCCTGCATTTTAGCCGCCGAGTATCCTTTCCACACTTAAAGAGCATTTAGG
CCTGTTCCTGAGGTATTTCAAAGATCCATAGTCCTCCGTTCAGCAGCTTCAAACCCTTCG
ATACTGCGACAAGGTACGATTTCCATAATTAAAGTGCTGTTATTTGGCTGTGGAGAGCTA
AAGATAATCTTTTGTGTCTCTTTTTCGACAAATTTATGCCTCCTTTTATACTTTTTTCCT
GATCCAATGTCATATCTGCTCTAGATTTGAAATTAGACTCGAGAGCCATATGCTATTGGC
CAAGTCCCAAGTTATTGTTAATTGACCATTGACCTATAGCGTATGGGTACCAGATTGTAA
CACCGGAAAAGGCTTTCAAATCCTCAGACTTTTGATTATATGTCGAACAGTGCTAGCCCC
GATTTTTGAACTACTATACGCTCACAAAACGCGTTTCCATATAAGTGTGGCACGTCAAGT
GGTATTGATATTGCGAGCTTGTTAGGGAAGACCATGGGACAACTTTGTCGCGATTGTCCG
CGGGTGAAGACGAACATTGGAATTCAAAAGAGACAGTATGGGGTTCTCCAAAAGGCCTAT
CGCTGAGGACTTGGCTCCCCGGCTATCTCAAATGCTACACTAGTAATGTACTCTCTGTCA
CGTGATTATCCAGCTGTACTCATTGTTTCGTGGTCACCTCATACGTCTCGTCCCGCCAGG
CTCAAAACGTTTATGTCATATCACCTCTTATTCACAAGTGAAATCATCAGGCATACCAGC
TCTCCGTATCTCAAAGCATAGTTCAACTAGTCTAGACA

The gene Kwal_55.20379 complement(379643..379978) is annotated in this region but switched OFF
[contig 149] FULL