>Intergenic-Kwal_56.23804-Kwal_56.23799 kwal_s_56 complement(710057..710215) 159bp
TCACATGATGTATGTAAATCTAAAACACGTGATTTCGATATAGAAAGTTTTTTTGATGTT
CAAAGCTTGTTTTGATTACCGATTCGTAATTCGTCGCGATGAGCTGGTTCATGACGGCTA
TGTACAACAGCAACAATAAGCAGTATCCAGTCTAATTCG

The gene Kwal_56.23803 (709914..710156) is annotated in this region but switched OFF
[contig 173] FULL