>Intergenic-Kwal_56.23583-Kwal_56.23589 kwal_s_56 (609824..610600) 777bp
ATCACACCTTGTGTTTTACATATAGGATCCAGATGCATGCTGATACAAAAGCTCGAAGTT
TTTGTATAGAGAGGTGACAGAGCTTATGTTTCCTGAGCCTTTGGGACCCGCTGGAGACCA
CTCATAACAATATACTGGGCTAAATCAGCCTATACTTCATGGTCAGAATCTCTATGCAGA
TTTAGTCACAGTACTGTATGGACATAGAGATATCCAGAACGTCGGTTTAACGTAAATAAA
CTATATTTGAGGTAATTAAGTGGGTATTAACTACGCGATGAAATTATGCGTTGGTCATTA
GATTCGCAGTCTGACAGTCTGACCGGTATAACTAAGTCAGCTTCGACAGTATCAACAGAA
CTCTATCATGCCACGGTTCACAAAACTCGAAGTCTGTGGGCGACGGAGTTTCGAGCTTAC
TGACTTGGTATCGACATACCAACAGGTTAAAGAAGCGGCGAAAAAGAAGTTGGCAAGGCT
TTGAGCCCTGTTACTGCGACATAGGAAGGGGTTTCTAAAGTGAACTCCGTTATATCATTA
AAGTGCCATTTATTTGAAATTTGTGTTGTCAAAGCCGGGCACCGAGGAACATATTCTAGA
AAGTGAGAACTTCTTTCCGCCGTCGTTAAATTCGGGGGGGGGGGGGGGGGGGGTCAAGCG
CGCTCCTTCCGAAGCTATGAAGACCTCATACTTTGCTTATTGCATGATAGAATTGATGTA
ATGATCTATTTTATCAAGCTTGCGATAGCATTAAAGGTGCCGGACGCCAATGATGAT

The gene Kwal_56.23588 complement(609601..609861) is annotated in this region but switched OFF
[contig 176] FULL