>Intergenic-Kwal_56.23583-Kwal_56.23577 kwal_s_56 complement(607333..607720) 388bp
CCCCGCGGCTGACCTTTGAAGATTCTCCTGCTTGCCTTATTTCTCTCATCTTCACGACTT
GTTCCTTCCCGTCGTCTACGGCCAACAAATTAAGAATTGATTGTTTAAGCCCTAATTTTG
AAGCCCTAATCGAAAAGCCCTAGGGCTTGAGGTATACCCGCGAGCGGCCACTTTTTTTTC
GACAAGTTTCCTATTATCTACTCGTATGGCCTTATGGTAGAGATAGTGTCCTTCAAAATT
GCTCACGTTCGAATCCTTTTCTCTTCTACTTTTATACATCATTACTGACGGTGTTTTCGT
TAGCCGAAACACTTCTGAATCAGAGGCTACCAATTTTGAAATGAAATTGACGCTCACCAA
AACTGGAAGAGCGAATAATTGAGGGCTA

The gene Kwal_56.23581 (607439..607609) is annotated in this region but switched OFF
[contig 176] FULL