>Intergenic-Kwal_56.22527-Kwal_56.22522 kwal_s_56 complement(168040..168164) 125bp
AACCAGCATTTTGCATAATAGATAGTATTTTATTAATGGATAAACCATTATTCATGGAAC
ATGTACACATAAATTTCATTGTCATTTACTTAATTTTCGATATAACTCCTTCAAAGATTT
TCTAC

The gene Kwal_56.22526 (168080..168388) is annotated in this region but switched OFF
[contig 185] FULL

The gene Kwal_56.22525 complement(167860..168129) is annotated in this region but switched OFF
[contig 185] FULL