>Intergenic-Kwal_56.22403-Kwal_56.22399 kwal_s_56 complement(111846..112079) 234bp
GGTTTCCAGCCAGATCAAACTACTTCAATGGTGCCGTTTTGCCAAATCAATACTGCTCTT
CAGCTTTTGTTTACTCAAAGATGAGATGTTGCCGAGCAACAGATACGCGTCGACCCTTAG
ATTATAGTTATATACGAGAAGTTGATATCCAGTTCATAATTTTAACCGCGATGCAAAAGA
AACCGAGCAGATATATACCTTTTGTCCTTTGAAAGAAGGAAATCCACAACCCGA

The gene Kwal_56.22402 complement(111953..112234) is annotated in this region but switched OFF
[contig 185] FULL