>Intergenic-Kwal_55.trna25K-Kwal_55.21459 kwal_s_55 complement(850349..851450) 1102bp
TAATTTTTGCTTCTTTGAAATTCGGTACTATTGGTATTGCACTTCGCGCAAGACCCCGAT
TACATGTGTAGGATTATGATATTCGAATCCTTTCCTTTAATGATCAATTTATTTATATAT
AAATATATATATTGTATGCAAAGTTTGTACGGTCATTGAGCTTTATTAGTTGATTTTGAG
AGCCGCAGTGTTTCCACATAAACTTTCAAACAAAGTAGCTTTAGGTTTCAGCTCCTCTGA
CGAGAGATTAGTACCCTTGACAACCTTGAATGCACCTGTACCAATAGACATGGTTTGCCC
TAAGATGATACACTCAGAAACACCTTCGACTGCATCTTTTTTCATGTAGAAAGCAGCATC
GAATAGATGATCCGTAGTCTTTTCAAATGAAGCTAATTGCAAAACAGAATCTCTCATTTT
ACTCAGACCGAAACGTGTGATACCTAACACTTCGCCCTTGTAGGTCATAACATCACCCAA
AAGTTGAACGTGACGAGGATCAACACTCATACCGTGATTACTCATGGTATAATCGATTTC
ACCAACGATACTTGTTCTGGCGGCTTCAATTCCCAAGACACTGACGACCTCCAAAATATG
GTTAGTCTTTGTCTTGTGCCCCACCACACCATCTGTAGTCATTACATCGCGGAGACCGTA
TCCTTCGACCAAAAGTTCTCTGCTTCCATCGCTTTTGATATTGATGACTGCTCTAGCAAT
ATCAGGCAAGCCCTTAACCACAATACCAGGTAAAGAGCGGCGCAAGTGCTGAACTCTGTA
AAATAGTTCGTTTTCGATAGGTTCCTTGGCGGATGTGGAGATTGATTTGAGTTTGGAACC
CTCTGGATAGACGTTGATGTTGACTTTGTCTTTGCCAATAATGCTAACATCTTGAGCCGC
TATTTTCAGCTTCGATGCCCGTGTAATTGCAACGGCAATGTCTTCAATTGTGAGCTCCAA
TTGTAGTTTCTCGATCGTTCCCAAATCAATCTTGACCTGAAGGAAGGACAGATTATCCTT
GTACACGTCCTGAATATAGAAGGCCACGTCAGAAAGTAGAGTCTTTTCAATTCTTCCTTT
CACGACTCTAGCTGCTCTTTCG

The gene Kwal_55.21466 complement(850698..850853) is annotated in this region but switched OFF
[contig 130] FULL

The gene Kwal_55.21464 (850323..851285) is annotated in this region but switched OFF
YOR116C (RPO31) - RNA polymerase III large subunit [contig 130] FULL