>Intergenic-Kwal_55.21444-Kwal_55.21437 kwal_s_55 complement(838507..839766) 1260bp
ATTGCAAGATGGCTTCTTCCTTTGTCAGTTTTGCGCGCTTGTATTGTGCAATGATGAGAT
GAGATGAGATGCGATGCGATGCGATTTTTGAAGGCCTTGTAAAAATTTGTAAACAATTTT
CCTGAAAAATCATGAGTACAATGAAGAGTACAGTATATATCAAACGGTCTAGTGAACTAA
CACAGATCGCGAAGTGACCATTACGAAGCTGAAATATATACGTTTTTATTGTAGGACTAG
TTTTCTTATGGAATAGTTCTAGCCAGCCATCAATATCATGTGGTCGGCAAAACCTAGAAT
ACTTATTGGATGGAGCAGGAGGAATTCTGGCATTAACGTAACAACACCATCCAAGGTTTT
ATTCACCATTAGGTACATCAGATGATTCTTGTCTTGAGGTAGGTTGTGATGGCAAGTGAT
GCATCGGATTGTATTATAATGGACTGATAATGCAATCACAAGATGATACATGATTGCATT
ACGCTTAAATCCATGAGAACAGGCCTTAAGATGTTTCCGGTTTTACAAAGGGCGCGTTCG
AAGTTCAGAAATGGCTTTACTAACAGATGTCAGATTTAATATCCACGAAATATCGAATGC
TATGAAAAGATCGTCATTAGTTCTAAGTTCAGAACCAGAAAAATATGGGATAGTATCAAT
GACGAAGAGGGGGGTTTAAATATCAGAAATGATGTGACTTTTCAGTTAGGCAGTGGAGGA
CAGATGATGAAATACTTTCGATGCTTGTAATTATCCGCGCTATCGAGCACGTTATCCAAA
GCTTTGATGTGGAATCGCTAAATACTTCTAATTGTAGGTATCAAAGAAAAAAAAGCTTTC
TTGGAAGAAAACCTACCTACAACCTAAGAACTCCAGGAACATAAAGTTAGCCACCAACCG
AATATACTCACCATTCTTATCGTTAAAATCTTGTATTATCCCTTCGTGATCTTACTTGTG
ACAAGTAAAACCAAGCGACGCAACGCGACGCCTGGATTTGAAATAGTGTCATTAAATGTC
TGGTTCGAAAAGGAGCTTAATTAATACATACTGAACCTCTTGACAGCTGAAAAGAGCTCT
ACGGTTGATGTCAGTGACTCAACGAGGCTATCTTACAATATAAATGATGAGTACTTGGGG
CGAGTACATCAAGTCACGTTATAGGTTCATTCACTTACCGCGCATCGCAATCCCCACATC
TGATGATCCTTTCCGATGATGAGACAAGTGGATAATAATCAAGAGTATTGGCTATAGAAA

The gene Kwal_55.21443 (839634..839792) is annotated in this region but switched OFF
[contig 130] FULL