>Intergenic-Kwal_55.21268-Kwal_55.21273 kwal_s_55 (761642..762120) 479bp
CAAAATCCAAAGCCGTGATTTACGTATTCTCTTATCGTGTAAGCTCGGACAATATACAAA
ACTCATTCTATTTAAATGATAAGCCTTTTCATAATTAGACTGGACATGTCACGCTGGAGT
CAAGCTCCTTGAACTTGGCCGGTGATCCTTAGCACGAGGTTAATCCTTTTTGGTACCGTT
ATTGCCATTTGCTTCTTGAACCGAGACAGCACTTGAGCCATAATATATTTTATAATTGAT
CAAGCTACCGTTTGAGACTTGATTGCTCCCTTAAGGGAGGCCACTGTTTGATATCAGCGG
CTAAGATGGTCTCAGTTATGGGGCTCAAGGTATTGTTTTTCAGGAGCATGCTTGTGACTG
CGCGAAGCTATATTTGCTTTCCCACATGGCCAAAGAAACACTCGGTAGGTGCTTTACATG
CGCAAACAGTGCTATGAAGGTTGATGAAAGATGTATAGACTCAAATATATCGTGGTTCG

The gene Kwal_55.21271 (761427..761720) is annotated in this region but switched OFF
[contig 130] FULL