>Intergenic-Kwal_55.21254-Kwal_55.21267 kwal_s_55 (754767..757684) 2918bp
CTATCACAAAGCTTCCGCAAGGATCTCGACGCTCTGGTCTCTTGGATAGTATACCGCTCA
AACCACACAAATCTTGTTTCCTACAAATTTTTTTTAACAGTTTTCAACTGTTTTCACAAG
TTTACTGCCCCTAATCGCGCTCTTAGGTCAACGTCTAGGCTTCCACGTGATTGTGATCAC
TACGCAAATCCTTTGTGCTTTTTTAACAATGGTTGCTTTCGCACGTTAACATGCATAGCC
AGTGGTACGAGAACGCATGTAGCCATTTTTCGGCCACGATTTGAAAGAAACAGGACAGAA
GACAGGGCTTGGGAGAGCAGCAGATTAAATGGAAGAAGCAGCAATATTGTTTGATTCATT
TTTTGTAGAGCGATGGCGTGGTTGAAGTAGCACCTGCGGTACAGCAAAGTTTCTTCAGAT
CAGATCGGCGCTGTGCAGGTTGTAGCGCTTGACGTGGAATAAAGAGGACAATCGAAGAGA
GTAAAACGTAGCATTGCAGTTCTGATGTGCAGAAGCATGGTGAATGTTTGGCGCTGGGCA
CCAGCAGTAAAGCAGATTGTAAATTTTTGTAAATGTGTTTGTCGGTGTCAGGACAAAGAG
GTGAGTCGAAGTAGCTAATAAGTATTGGGTGATTCACAAAGCCACAAATTGAACGCAAGT
AGTGAATGGCGTTTCAGAGACAGCATCGGTATCGGCTTGATCTTTGAGATATTGCGTAGT
CGGGTATTTTTCGTTTTCACGTTCGGTGCATTATCGATTATGAGGCTTAGAGCGGGAGCA
GGCGATTTACGTCCTATTATCCACGGAAGGTTACTTTCCAGCGTAAAGAAAACGTAACCA
CACATACCCATTAGAAGAATCCTGCCTCATTAAGGTGGGTACTTTTATCAGTTCGAACTG
CCACTGCATTGTGGTCGACTCGCCAGCAGTTACCAAGGGGCTCGGCCGGGACCTGGTGAC
ATAGTTTGCGATGGAGCCTTACAAGGCACACGGTTAATCTCGTGAGAGAACTTGCTGCGA
ACTCTGGGCTTTTTCAAGCGTCCCGCGTGTTTGAAAGGATGCATTTATGCGGGGCAGCTC
CGGAAATTAAAGTTTTACCCGCCCTATGCGCGAATCTCAGAATGATGTATGCAGAAAGGC
TCGGCAGAAGTTGCGCTTCGAGAAACAGCCAAAGGGCTGCAACATGAAAGTTCGGAACAC
CGGGCGGGAAGTGAACCGTCCATTCCATAAAATTTTCACAACCTACTTCAGGTCTGCTTC
GTCCCTCGCTTTCACGACACGCCGGCGGGTGTTGCGTTCAATCGTTTGTCCTGATATGAC
GGCAGAAACGGCTATTGTCGGTTGCTAATAGAAGGCTCTGTAGTGTGAAACGGGCTGCAA
AATTTAAGTCGTACTCTAGCGATTAGGTTAAAGTTTCAACTTGGATTTTGCAGTATGTGC
GTGCGCCATGAGATGTGATAACGACTCTTAGTTTGAGCAATGAAGTTATTGGAGTTGCGG
TGAAAGTAAGACATTTCATTGTAGCACTTGATCGCGAGTCAAGTTATATTCCTTACTTGA
TCTTTCTTGAAAGACAAACCAGTCGGACGTTTCCAAGACCGATATCACATCATTTGAGTA
ACAGCTTGGTATACCAAAGGTTATGATAACTGCTGAAAAGTCAGCGCTAGCTACATTTCC
CGCCAAATGATATTTGGCTAGACTAACATTATTCCATTGCTTTTATTTTGGCCTTCCCAC
GTCCTTGTTTCAATGTGAGGTAATGAATATCTAAAGACGTCTTATCCCAAGAAACGCCCT
TTTTTATATATTTCCTTGACAGGAAAACAAAGGGCCCCTTAAACCAATATGAATATACTC
TGAAACAGAGGAACAATTGAAACTGGATAATGCAGATTCTGGGTCCTCTATTATCTCAAG
GGCATCTCTTGAGAGCCAAAATAGAGATTGAGCGGTTGCAGCGTTTGTTTAAAGGACAAG
TTGGGTATAATATTAGAGACTGAAAAAAAAAATAGCCGCCGAAAAAAAAAATGCTTTTAG
GAAAAGAACTGGTTTAGAGAGTATCAATGAGCACAGCAGCAGACCATGATTATTTGCAGC
TTTGACCTTGTTAGAACCTTTTTATGGACCTCGGCGGCTAATTCTGTGAAGTAATGAAAG
ATCATCGTACGGCTTCAAAAAACGAGCTGCTCTTATGGTGAACTTACTCAAATGGATTCG
GTAGTTAGTTGATATGACGATTGATCAAGTCTTGCGGTAGCGGAACGAGAAACCAACTTT
CAAGTCGATGAATGTATCACAATGAGTTACACGGAGTTGAGCTTCTAAGGCTATCAAGTG
CTTCATGGCTAGTGATCGTTGTAATTTGGAGTCCAAAATATACGCGTAACAGCAGGTAAA
ATCAAAACCAAACGTAGCAGACCTCTTTATCGCAAACGACTTCCAACAATAATGAGCTTT
ACCAGGTCTTTACAAAAGGACCCTGTTAGTCGTTTTCGACCCCTTTGTTTACTAGAAACT
TCTGATTCTCTCTATCCTTATGCTAAAGTGGCCCTTGTCTTAAGGTTCGAGTATTCACAG
CATTCTAGCATCTAGCAGAAGAGCACCTACGACATTAGCCGCAGACGCATCTTTCAACCG
TTGACAATTGGACTTTAACACTCGGCTCTTCTTGTAACCACACTCGAGGGCTTTCCCAGA
TAAGAATCGATTAACGTCTCAAATCCTGCGTCAACGATGGGGCAACAGCGATCATTACCA
CGTTGAATTATGACGGTTAATTCCCCTTGCGAAGATTACATCTCATTGATAACTATAACA
GCTTAGTTCGTACTCTGTGCTATTAAAGTTCCCTAAACTGATCAGTACACTGTAACAACA
ACTCACCTACACATCTGAGCAAAAGTTCATCCTGTATC

The gene Kwal_55.21262 (754589..754900) is annotated in this region but switched OFF
[contig 130] FULL