>Intergenic-Kwal_55.21246-Kwal_55.21240 kwal_s_55 complement(746790..747273) 484bp
GACGGGAGGTCGAGATGCTATCTAGAGAGGTATCAGTTGCAAGAGATGGGACGCCAGGGT
CTTTGTATATGTTTGCGCGTGGGTGTGGATGTGTGAATTGTTTATATAGGATCTTCTGAG
CTCTAAGTTAAACCCTGAAGGAGCTGCAATTCATTGAAGATTTATCGTGATGACTTATAA
TGACAGGTCTTTAATGATTTTTTTCGATGGAAAGAAGCTAATCTACAAGTTAGAAAGGAG
AAATAACGAACAGAGTAGGATATTCAAAGTGAAACACATTCGCCGGCGCTTTTGGACCTT
CAAGAACTGTCTACTAGCAACTGGCCATGTCAGTACATGACTTGAAAACAGTGCAGTATT
GATTCTTTGTAGTCTAGTATATCCATCACTAATTACGAACCCCTTAGCGAACATCATTTT
AATTTCATTGCCACTGTCAATATCAATCAACTTTCCCCTTCTAGTGAGAAGAGTTACGCA
GAAA

The gene Kwal_55.21244 (746857..747051) is annotated in this region but switched OFF
[contig 130] FULL

The gene Kwal_55.21243 (746615..746800) is annotated in this region but switched OFF
[contig 130] FULL