>Intergenic-Kwal_55.21222-Kwal_55.21226 kwal_s_55 (737476..738729) 1254bp
GACTCCCTTTGGATCCAAAAAGGGTAGTGCGATCGTTTGGGAATGCTGAAAGTGAGGCAA
AGTGTAGATATCCACACTTGTACCATGTAGTCTGTATACCTTGCCAAATTGATACACCAG
TTTGGAGCCTTTCAAAGGCAGATCTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCTGTCCGATTTCAACAGCTTAAAAGAGACTTTGCGGCCATCTAGGTCGCTAA
GGAGGAACATGAAGTCTTGCTTACTTTCGCTGACAAAGTGCTGCACGAACTGAACATTCC
CATAGGAGGAGTCAATGGAATGCTGTAGTTTCAGATCGTAGTCAAAGAACTGGATCAGAC
CACTCGACAGAACTGCTACGATGGATTTCGTGGCGGGAAAGACCTTAACGTTCACGGCCT
GGTTAGCAAGGGCTACTTTGTGAGTGGCGTACGTCTCTCCAAAGCTAGAGTCTGTAGCAG
CCGAAGGAATGGGCTTCTTAACGGCGCAAATAGAGAACGTTTTGTTTGCCTGAAGAGCGT
AACAGAGCACTTCGTGAGCTTCAGCGGTTCCCTCGTTGTTAGTGCCTGCCACTTCAGCCA
CGTCGCAAGCAGTCACAACATTGGTGGACGAGATAGGCAGGTTATACACCAGCTTCGGCG
TGGGATTTATCACGTATTGAGAGATGGCTGAGCCAGAGATCCCCACATTAACTCTGTTTG
TAGCGGGTGTTAAAGTGTCTGCAACTTGCAGGTAACTTCCCTGTGTGGCATAATTGTTGA
GCGAAGCAATCTTGGGAAGCGCTGTGAGCCGGAATGGCTGTGAAATGGACGGCATAAGCG
TTCAAGACGTGAGAGGGTTGCGAATTCAAGTTGTTCTTAGCTAGCCCATCTCATCGCCTC
ACGGGCGGCGCAAATTTTTTCAAACAGGAACTACCATGGATAATAACATTATACGTCTAA
TGTGATGATGTACTCAAGATCACGTTTTAAAAAGGACTCGAGACAAGTATACTGGGTGCG
TTAATAGTGATCAAATTACAGGTTCAATTTCTTGAACTTTGTCACATGACCAATAGCTTT
CTAAGTGAATTGCGGGATACTAGCGATGTAGCCCAACTGATGAGCAGCTATAAACCAAGT
CGACTTGTGCGTACTACATTCTGCAGTAAAGAGGGTTAGGTAGTCAGCAGCTAA

The gene Kwal_55.21225 complement(737726..738370) is annotated in this region but switched OFF
YGR128C (UTP8) - Protein required for cell viability [contig 130] PARTIAL