>Intergenic-Kwal_55.21206-Kwal_55.21215 kwal_s_55 (731362..733384) 2023bp
CGATACTGCAAAAACTATACTCAATATATACACACTCTCTCAATACCTCAATTGAAAGCA
TCACTAATCAAAGGGTTACTGTAGCGTACCTCTTACTCTAGGTCGATTTCAATAATCAAA
AAAGTTCGGCCGAACCCATATGGCCAAGTAAATTTCCTAAGCTCTTGGCAAAAATGACTG
CTGCTTTTTTTCTGCAAGTCCGACCTACGCCCGTTGAACTCAATGCCAAAACAATGGGAA
AGTTTATGGATGATTTTAGCTAAGACACGGAGACACTTGTGAATCTCCAGGGTGCTATCA
AAGAGTCTCGATCCTTGTCCATACTTTCGCTGGTTTCTCATTCACCTCATATTTAAAGGT
TTACACCGGTCTCATATCACTTCGTACCATTCTGTCATTTGCCAATTTGTTATCGCACAT
CGATAGATGGTCTAGATCTGACAGTATTCTATTTCAAACAAGGGCCATCTGTAGGACACA
CTGGTAACAAAGTGAGAAGAACAGAGCCTGAAAGGATCTCGAAAATGTTCAAAGACTCCA
CGGCCAACCCATCAAAAGCCACATAAATTAATCCCTCCATTCGCCAATTTTATCCCTACT
AATTTCTCTTTTATTTGTAGCCCATGGACCTGAAATTAGTTCTTGATTCATTAACGAATT
GTTCTGAAAGCTAGCGTCCTGCTTGGTCCAGTATATCAATTGGAAAATACAGGACCACCG
CAAGAGAATATTGAGGCGAGTCTGAATCTTCGATTGAAAGTTTGTTAATTTCAATTTCAA
TGTTTTCCATAATGAAGTAATATGATCAGTATATAGGTGATGGTTGTAAGTATCTCTCCG
TGGCTCTTTTAGTCCAAGAATAAAATCTTGACCTTTGACTAAACCACCGGTATTTATACA
AATTTCTCAGTTAGTAATTGGCAGGGTGCAGTTTAGCAGCTTGCACCCATGACGTGAGCT
GTTGCCATCTACCGTGATCAATAGAAGGTTGCAGTCATTCAGCCACACGTTTGCCTGGTT
CCCATCCAGTTCTTGCTGATGTAGACATCAATTATCATTTCGTACTAATCTGACATTATG
CAATTTGTACTATCACACATTGACAGGCGGTCTAGTTCTGACATTCTGACAGAGAAAATA
GTGAATGGAACATGAAACACTCGGATATCAAAATGAAGCCGACTGTCAGATACTCACAGC
TCCAAAACCTGCGTAAAAACAACTAGCTCACATGTTTGTTCTTGATCCAGAACTCAAAAT
GAGCTTATATTAGCCCGTAAATAATGCCCAAGGGTATCAAGCTCAGCGGTAGCTTGCCAG
ACATTCTGATAATGCTTTATACACCAGGCTCATATAGGCTATTGAATTGGAAACCAACGG
ACAAGATCATTTTCAAATTAAGGACTTCCGTGATTCTTGTGCTCATTTTTGTTCCTTGAA
GTTTGACCTTCATAGGGATAACACCTATACCAAATTCAAAGCCCGCAAGAATAACAAACC
CAAGGCAGGCTAAATAACAGGCCCATGTACATATTAAAATGGTTGAAAAACTACAAAATA
ATGAGTATCTGAGAGACGGATGGACACTTTCCCAGGTTTCACTTCTTCTGTTTCTAGCCG
TCATTAGTGCTATCGACCAGAAGAGAGATATGTATGGCTCTCTTAAAAGAGCGCGGACTA
GACGGTCAGATTATTTAGATTAAAAGCTGCGATTAATACTGGTAGAAGCAGGGAGGCGGG
TTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTATCTTCATCTGA
TTCTTTCGAGCCCAAAGCTTTCGAGGGCAACCCTGTAGAGCTTAAACGGCGAGAGACCAA
CTCTGCATCGTCCGTGTCATCATCTGGGAACCCAAAAGATGCGAATTCTATTCGAAGCAA
TGGCACTTTACGGAAACAAGACTCCAACGTCATCGAACAGATC

The gene Kwal_55.21212 complement(732698..732985) is annotated in this region but switched OFF
[contig 295] FULL