>Intergenic-Kwal_55.21194-Kwal_55.21201 kwal_s_55 (725835..727205) 1371bp
ATTTAGAAAATAGAAGATACACAGCGACTACCTGAGAAACAATTTGATAATTCTTGGGTG
ACGCGCCTACAAATCATTGACTGAATCCGCGTCTTTTACTTCGTTATTTGGCTATTTAAT
ATATGTTTGAAATACTCTGTTATGATGGCGATTATTTGTCATTTCAGGGTCCTTGGTTAT
CCTGTACCTATGCACGCTCCTGTTGACAAATGTGAGAAATCGGCGGCTTTCAGCGGCTTT
GATTCCGTCCGAATTCCGTTACGGTTCCGCGGATTTCTTAGCGTCACAGTAAACGAGATG
AAAAAAGTACTACAGCCTCTGCTAAGTGACGGAAATGATGCCTAAGCAGTATGCCGTTAC
CTGAGAGACACGCACAGGTCTTAAGACGGAGTGATATGGAGCGGATATTGACGGATGTTT
CCGTACGGAAGCTATCCGTAGATATGGACTAGAAGGCATTATGAACGAGGAGTACAGCAC
GTGTCGCAGGGAGGAAACGGATCATGTATCACGTGTAAGACTTTACTTTCTATTCTAGCA
TTATGAACGAGTATCAGACACGTGCCACGAATATTCAAATCACGCAACACGAAGATATTT
CAAACAAGGCGTATAATTCCTATGGGGGCATTATAAGTACAACTACAACGATCACAAAAA
GGTTGGGATCCCAGAAACCAGGGGCTTGAAGGAGTCAGTGGCCAGAAAATAGATATGAAG
CAGATTGTGATGTCGATCGACATGCCATAGGAGAATACAGATAAGTTGTTGTGTCAGTGC
GTGGTTTTTACAAGTTGGCAGTTCAAAAATATGAGTTGAACGAGGGTTTCTAGTTTTGTG
TTCAGGCTAAGGGCCACAGAGAGTCCCAAGTCATTGGAGATATTAGCATGAGACTGTTGG
TATTGATATTCTGCATATGGTCTGAATGTGATGAAAAAAAAAGACATTACTGTTAGGGCA
GCCTACTTCTTATGTCAAGCAAAACGAGCCTTTTGCGAGGCAGTGCAATGTGTGATATAT
TATGCCACACAAAAACCGTTATTCCAAAGTGCAAGACGATTGTTTTTCTTCCAAGACCTG
GACCTTGCCCTTAGACGGTCGGTTCTCAAGTATACCACGAAACCGATCAGCGTTCAACCG
TTTCAGCGCTTCGTTGTTTATCGGAGTGCCTCTTTGAAGAGCTCGGCGGCTAACCGCGGC
TTCTCGAAAGCCAAGGGAACCCAAAAAAAAAAAACCCCCAAAAAAAAAATTAAATTCCGA
GGTAACGTGACCTAAAGGGCCACAGTTTTTTCTAACTACTCCTGTTCAAGCTAAAAATTT
GGACTGATCCGAAAACACATCCACATGTGCGAATACTGCGTGTGAGACACA

The gene Kwal_55.21197 (726765..727109) is annotated in this region but switched OFF
[contig 295] FULL

The gene Kwal_55.21199 complement(727126..727305) is annotated in this region but switched OFF
[contig 295] FULL