>Intergenic-Kwal_55.21181-Kwal_55.21187 kwal_s_55 (722278..723403) 1126bp
CAAGTAGCACCTTATTTTCTACTGCCTACTGTATCTAGGACCCAGCAGTAGCGTTAGTGC
TGATTGCTTAACCATTTAACCCCGGCCATTAAATATACCGTAGATCAACGTTCGCATGTT
GATTCACACAGCCCGGAGATTTCTGCCCTTAATGACATGCAAGACGCCCCGGCATCGCTT
CACCCAAAATAGAACTATACTCGTCAATCAAACTCGGCTTATAGAGCCAATCTCTGGTGA
ACACCCCAGCCCATCACTTCCAGAACCTCTGGGCCCTAAACCACTAGCTTAATTCCACGT
ACTACATGACCAAACTTTTTCTATATAAGACGCAATCCTCTCTTCTCACTTGGTTTTCAT
TTCAATACTTCCTCTCCCATGACCTTCCAAGTTTTATAAAGAAGACGATGAGCTTATTTG
CGTTATTTCAGTCGAACAATTCTTCTCGTGCGGGCGCTCGCGCCTGCGTGAGGTTTTAAT
GGAGAGTGTGGTTCCTGCGCAGCCCTTTAATCTTGTTACATTCTATGAATGACAAGGACA
CTTTATAGAAAATTCTGATTCTTTCCTTTAGAATTGGAGGTCACTATGTAAACCCCCCAG
TAGTTCTTGTCCCACAACTGCCTGCTTGCCTTTTGAGCGACGAGTACGTCGTCAGCACGC
AGCGCAACAATGCCCTCACAAAGGTGGATCCAGTGCTTCAAGATGCCGGCCTCGGATCTG
TATGCCATACACGGCTTAGGGCTACACTGACGAGCTATAGAGCACATAGATACTAGGAAC
TTTGGGCGAAGATGCCTCGCCAAGGCCGCCCGATTCGGAACGTATCTTACAATATCGCGA
CTCCCGGGGAACGATTCCCTTCAAAAGTTGCCGCGCGCCAAATGCTTGCTGTAAACCTAC
AATCGGGCATGTACTCACGTTCGATGAGTCAAGTTTACCGGTCGCTATTATTACTCATTA
GTAGAGTGAAAAAAAAATAATGATAAGCGAAAGATTTTTCGAGCATGTCGAATAAAAAGC
TATAGTTGATTGTTCAACAATAAGTTGGAAGCTTTCTTGTCAATAGTTCAAGACAGTTAA
TACAGTTTTTCCGCTGGATTAGCACTACAAATACAGATTCCTCAAA

The gene Kwal_55.21184 complement(722820..723044) is annotated in this region but switched OFF
[contig 295] FULL