>Intergenic-Kwal_47.18642-Kwal_47.18646 kwal_s_47 (909571..909621) 51bp
GCACTGCGACTCTTCACGTCTATGTATAATGACTATCTGTGGGAAACAAAT

The gene Kwal_47.18645 (909599..909931) is annotated in this region but switched OFF
[contig 191] FULL