>Intergenic-Kwal_47.18631-Kwal_47.18642 kwal_s_47 (906348..908640) 2293bp
TCTGCGTGAACTTTGGTTAGTTGTTATTTTTTTTTTTTTTTTTTTGGAATGAGTGAACTT
TTGATGTAACGCTAGAATTTGGTTCAAATGGGGATGTAAATGACAGAGCAAACCCTACAC
TTAGAGAGTAGTGCTTCTCAGCTGTGATTTCAAAATACTTGTCTATCTCTAAAAATACTA
CGTAAATAATAAAATGGAATGGTTAAATATGTGCAATAATCAAGGGTCCAGTAACCGGAC
TCGACACTTTTTGATTTGAATATCCAAAGCTACGGCCTGTGAAGCCTAATGGAGCTTCAT
GCTCTATCGCAAGTGAATCTCCGGTTACCTGCTCATCAATAAGACCCTATCTGGATTCGT
CATTGGGTCTGAAATAATAGGTAGGATCACTAGATCTTTTTTGGTGCATAAACCATATGA
ATATGTGCACGCCAATGGCTACTGAATTCCCGCTTCGTTCTCAAAGTCTACATAGCAAAA
TATGCGTTTTACAGTCCTACACATATACAACTACAACTCTTAAACGCGATGCTCATTAAA
ATGTTCATTGCATCATCCTGTTGTCAGTTTTGGGCCGTTTTTTTTTGGCTGAAATTCGTG
GCTACGTTTCAGAATACTATAAAACCTAATTCAATCAGATAAACTACCTTTTACGATTCC
CAACAGAAAGTTATCCTTTGAGATACTTGCTTGATTCTGTCATTTGAATCATCAGTATTT
TTTTTATTTTGGAAATTGTTGTGGGGAAATTGCATAGGGGGAAAACGATCGTCCTGTAGC
TAATGGACACTTTCATGAAAAATCAGTTCGAGTAAAAAGAGGGAATAAGACCGGATTGAA
GATTAAAACGGTTATCAATAAGCCAGGTTATTGCAGGTCTAAAGGCATTGTATACAGTTC
AAGCTTTATTGTACTCTGGCTTCTTTTTATAAGGATCACAAAGACAAGAAGAATAGCATC
GCAGCTGGAATTGTTGAATTATCATTAGTAGGTGGAAATCGCAACCATTTTTGAGAGGAT
CATGGGTAACAATCCATCAACTGCAAATATGCAGAACAGGCGTGTGAGCCAGTTGGTCAA
CGACTCACGGGGGCGCCAGGACTCCATCACGTCACAGCTGTTTCCAAGTAGAACTACAGG
CAGAAATCCTGAGGAAAAAAAGGGCTGGAAATCCAGAGTACTTCACGGCAAACGTGCGGG
GACTACGTCGCCGTCATCGGCGCCATCTCCTTTCAGGAAAGATTACTCACTGGACTCGGC
AAGCGAAACAGCGTCCTACAACTTTAAGAAAAGTGCTTCTGGCAATCCTGCACCTCCTAT
GTGCATTGCAGCGCATGCCAGTGCAGAAGATTCATCGTCTTTGTTACTGAGAGATCACCT
GGCAGAATTATCGCTGCAAAACTCGGAAAGTCAGGCCCATGTAGCGGCAAGCCCTGCTCC
ACTTTTGCAAAGCCCTGGTCCTTCATCTCCAGTGGTTCAGTCCACTAAGCAAGAAGCGCT
TTTTGAACAGTTGTCTAGTATGACGTCGTTAAAGAAAATGCTTGTTGAAGGAAGGATAGG
TGACCAGATTAACGCACCGCCTTCATCAATCGACATTCCTCGAAGGCCTAGTGTTGCAGT
ATCCGATACGTATATGTCAGACGACGGAGACGATGAAGAATCCCTCTTGCAAGGTGTTAA
TGACGTCGTTATCAACAACTCTATGTTAGAGAACGCTATGAAGCGAAAGCGCAGTTCCAG
GAAAAACAAGGCCTTGGGCGCTTCCTGCAGCTCACGAGAAACTATGCCCCATTCCGGTCT
AAAGAAACTTAAGCCTCTGGAACCCGCAAGCGACAGAATCAACCTTCCCAGCTTCTCCGC
TATGCATGCTAGACCCACAGAAAACGATTACGATCCAGATTCTGCGGCGGTACCAAGGCT
TGTACCCGATACTTTCGATCGTATTGGGTCTTTTGAAAATGGAACCGTCGAGCATTATGA
AGGTACAAATCAAAGTGATTTTAGCTCTCAAGGCGTCAACTCTTCTGACTCAGGAAGTTC
CGACGACACTAATAGTTCTATTCAAGACACCCACGTCATATTAAAATGGAAGGATAATAT
TGTAGATCCCAAGTCTTGCAAGATGTCGATTGTTAGCAAAGACATATGCCTCTATNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATCTTGGCTCGCGAAAAGGTTTA
CAATAAAATACCC

The gene Kwal_47.18638 (907369..908499) is annotated in this region but switched OFF
FRAGMENT OF ADJACENT GENE -
[contig 192] PARTIAL