>Intergenic-Kwal_YGOB_HMalpha2-Kwal_33.13003 kwal_s_33 (32702..35424) 2723bp
AATTTGTTGAATTGCTCTAGAATTTCATGTCCTTCTCACTAGGTTGACAACAGCATTTCC
TTAATTATTCTTCCACATCCTTGCTCAACTGCCGTAGCATATACTCAGATCCTTTTGATT
TGGATCCTCACAATGCAGTATCTACTCCAAGTAATTACCTTTACATGTAGGATATGCGCT
TTTTTTCATTCCGCTGATGAGAAATTAGTCCGGCAGTTGAGGGTGGTTATCTCTTATCCC
TTAAAAAACTGACCGAAGCCATTGGAAGAGAATGCATACCATCAACCTACAGTTACGAAA
CGCTGACCAATGGGGCACACACTACAGCCATCGAGAGCAAGAAAACGTACAAGGCGTTCT
GTGGCAGGTTCTCTCTCAACGAGGCTACAGGTAGGGTCAGGAAGAAGAAACCTATACAAA
CCTTCGCCCTCCGCTCCGCCAACATTGAAGATGTCTTTCTCATATACCTGCCTCAGATCA
TATAAACTTTCGGTCTGTGTCCTATTATTTTTTATTATTAATGAATTTATATTAAAAAAT
GAAGTTATGAAGGCTACCTTGGCACAAACTGAAAATAACTGAACGCTTTTTGGAATCATA
CCCAGAATATTCATAGTTCATCTGTTAATTTTGCATGCGTCTACGTGATAGTTGTATTAT
TATTTATGCAAGCTTTATCGGTCAATTAAAGACGAACTGTTAGACCGAACCACCAATATC
CATATTCTTGAACTTATGGATGGCAGTAATTGGAATTTGGCATCATACAATTATGCGCTC
AGCAAATATCTGCTCGAAGACGTTACTAATAGCTTAGTTGTGGGTCATTTGTTCGTTCTT
GGTTAATTAAAAAGGTTCAAATCATATATCATTTTCTACTTAACTGACGTTTGTTTTTAT
ATTGGGTGCTCCCTCATCAACACCAAATAAATGTCACAACTTCAGATTAAGGAGGGAAGT
TTTCAAAATCAGTGGTTGTTTGATAGTTATCGAGAAAATGCGGTATGCGTTCATCTCTAG
ATTCAGTTCCAAGTGTAATCAACTGTGGTCTGTTACCAGCGCTTTAACCAGGTGAAAGAA
AAAAAAACACAAAACACAAAATGTATGTCAGAAACATTAAAATATTGTTTCAGGAGCGAC
TGTGAGGTACATGATGATAAGAGCGCGCCGCGCGTAATTCCTGATGTATTCTATATGCTC
TTCATAGACGGTCTAACAGAGGTAGGCGGTCCAATTGCAGTGCTCAAGGACAATGAACTA
GAGACACATGACACTGGTATCTGATAATTCTCGTATTATTTTTCTGCTCCGATTAAAGTG
CTCATCGTTATCAAAATCAAACGGCCTCTTACCTTTGATTATACCAGATCTAGACTACTT
ATCGATGTGTGATAGTACAACTCGCTTAATGACCTTTAATACGAAGTGATTCGGGATTGG
TAAGACCAGTGAAGTAGTAGTTAGACAGAAGTTGAAGGAAGGCCCCGAAGTATCTCGAAG
AGCCCAAATCTTGGGTAGTTTCTCTGGCATATGGAAAACTAAATTGGGCGTAGCTGTTAT
CTCACAGCCAAATCCCCGTTCTTCCACTTTGTATGGTTTTCATAGCTTAATTGAGAAACA
GAATTTTTCTCTTGGACCAAGCTGACCAGAAAAATCTATTTGCAGCCATCATTTACAGAT
AAAAAAGCTACCTTACTATGGAAAATGTAGCCACTCAATGAAGTTAGCTTTCAGTGGCTA
GGTTTTCCATAGTTAAGTAAACTATTTAATATGTACACAGTATATTTGGATAATCTGAAT
GATACTTTCAGTACGAGAATAGAATTTTGTTCCTAGATCAACCCATCGATATTTATACAC
ATTGCTAAGTTGACACTTGGCAATGGGTGTAGCTTTGCTACTGTAGCCGTAGAGTGAGTC
TTCGTCACTTGATATGAGCAATCGGAGGCTCTAGGTTCTTAACCAAACGCTCGTCTACTT
CTTATATATCTCTTACTGCACTGGTACACCTGTCTCAAATCACTTTGTACCTATGTGTCA
TTACGTAGTTTATACTATCACTATGTGGTGTGCATATAACATTTTGGTAGTCGGAAACGC
CAACTGGATGTTTAAGGTAACTCCAGTATGCAAAAATCGTTGATATTCATAACACCTGAT
GGTACTAGAGTAACAATCACAAGCTATAACAAAATAACATTAACAATATGGAGGGGATAT
CGGACTCCACAACCTCAGTGAGAAAAATTTTGGCCTCATTGATCGTGATTTTAGTAATTT
TTTTAGTAGGTGTGATCATCGATCTTACGGCCCTGATGTTTTTACTGATGCTTCCGTTGT
CTGTGGGAGCGTCCTTGATGTTGTCGATAGTGTTTTACAATTGTATAATGGCCGATGGTT
TATTGTAGGTACAAGAAGGTTTCCTAAGGTTAAAGAGTCAAGATTATAGCTGATAACTGA
GAGTCGCCAAAATGGCTCTGACTTCGTTATCTTCAACTTGACCCTCAAGTGTATCTTTCT
TCGTTATGTATGATCAGCGGTTTTTCTCTCAGCGGTAGCTATGATGGAATGTTTACTTTT
CGAATGGACCATAACTTGAAGGAGGAAGACATGCAGATCGAGGTTTGAGAAAGAAATATA
TATAAAAAAAAAAAGTAAACAATTAAGTCTAAGAGTAGAGAAATCAAGTTTGCATCGGAG
GACAGAAGGACATCTAGACGTGT

The gene Kwal_33.12996 complement(32983..33315) is annotated in this region but switched OFF
[contig 123] FULL