>Intergenic-Kwal_27.11537-Kwal_27.11542 kwal_s_27 (841325..841388) 64bp
ATATGGAATAGATCGAAACTATCTAATAACAGATTTTGATAATAATGCATGCGTGAGATT
TAAA

The gene Kwal_27.11541 complement(841066..841374) is annotated in this region but switched OFF
[contig 27] FULL