>Intergenic-Kwal_27.11532-Kwal_27.11537 kwal_s_27 (839012..839197) 186bp
TTGGCTCAGTTATCCTTACTAGTTGTGATTTTTGTTCGAATTGGATGTCGCGATGAGCTC
TAATATTTTTAACGTCTTGAAATTTTTGCTTAGATCAGATGTTGAAGCAGCAGAACTGTT
GGCAGATCCAAAGTGACCAAGGTTTGGGCTAGTTACCAATTTAAAGTCGCTAAAGGCTGA
TGAGTT

The gene Kwal_27.11536 complement(839030..839617) is annotated in this region but switched OFF
[contig 27] FULL