>Intergenic-Kwal_27.11513-Kwal_27.11509 kwal_s_27 complement(831936..832027) 92bp
TATGCTTCAGTTCCACTTAATTGCCACTTTTCTTGTCATTATAGTATATACATGTAAAGG
AACTCTGATTTTTGTATATTACATCTGTTAGA

The gene Kwal_27.11512 (831796..832011) is annotated in this region but switched OFF
[contig 27] FULL