>Intergenic-Kwal_27.10292-Kwal_27.10286 kwal_s_27 complement(276565..276770) 206bp
TGCGTGTACTTGTGGTATGATTTCGCCGTTTTTTGGGTCAAGACTCGAACGAAGAGCATG
TAGGTGATTTATTTTTCAAGCTTAAACTGACAACTAGGCGATGAGTTAATGAAAATAAGG
TTTGAAGCTCCCCGAGCGGGCGCTTCCCACGTTAATGTAGATGCTAAATAGATATGCTAT
AAGTGTTTTGTTCTGTGGGACACGCG

The gene Kwal_27.10290 (276402..276665) is annotated in this region but switched OFF
[contig 37] FULL