>Intergenic-Kwal_27.10263-Kwal_27.10272 kwal_s_27 (270976..271404) 429bp
GTCCCTTAATTGATTTATCGGTTGATGTACTGCTCTTCTCGAATGTTTCTCCTAGAAAAT
TTTTTTGTAATCATCACAGTCTTTTGAATATCTACGCGCTATGAAATGGCCATAAAATTC
AAGTTTTGAAAGGCCTTCAATATATGTGATTCCAGTAACCTCTGCATCTATCTTGAATAT
GTTGATAAGCATTATTTTTGAAGGTTCAACTCTTCGTTGAGATTCTACCTATAACTTGCC
CAGCTGGGAGCCCAAAGCCTTTAAAAATCAAGAAATCAATGTCTGTCTGCTCCGCAGAAT
AGACCCTATGATGACTTTCTAATGTACATTGAAAGCCAATCATTTGGTGGTAAGCCTGCC
CCTTATGCATTTCTTCTTCGCTTTTGACACTCGTCATTGAATCACCCAGTGCGAGCTAGG
CCCGGTGAT

The gene Kwal_27.10271 complement(271377..271799) is annotated in this region but switched OFF
[contig 37] FULL