>Intergenic-Kwal_27.10272-Kwal_27.10263 kwal_s_27 complement(270976..271404) 429bp
ATCACCGGGCCTAGCTCGCACTGGGTGATTCAATGACGAGTGTCAAAAGCGAAGAAGAAA
TGCATAAGGGGCAGGCTTACCACCAAATGATTGGCTTTCAATGTACATTAGAAAGTCATC
ATAGGGTCTATTCTGCGGAGCAGACAGACATTGATTTCTTGATTTTTAAAGGCTTTGGGC
TCCCAGCTGGGCAAGTTATAGGTAGAATCTCAACGAAGAGTTGAACCTTCAAAAATAATG
CTTATCAACATATTCAAGATAGATGCAGAGGTTACTGGAATCACATATATTGAAGGCCTT
TCAAAACTTGAATTTTATGGCCATTTCATAGCGCGTAGATATTCAAAAGACTGTGATGAT
TACAAAAAAATTTTCTAGGAGAAACATTCGAGAAGAGCAGTACATCAACCGATAAATCAA
TTAAGGGAC

The gene Kwal_27.10271 complement(271377..271799) is annotated in this region but switched OFF
[contig 37] FULL