>Intergenic-Kwal_27.10258-Kwal_27.10263 kwal_s_27 (267475..268743) 1269bp
TTGATGTTACTTGGATAACTTTCCTAACCTTGTTGTTGCACGTTTTATAAGTAGGTGTGT
TTACTTTATGAGTGTGTCACTTTCTTTAAACTGTGGCCTGGAACTGTGGTGGAACCTTCG
GTATCTAATCTTGTGAAAAAGGTACTTAGGTCGCCGGACAGCTCAGAAGAGCCAAAAACA
TTTAAGAAGCGCTCGGTCAGTATGAGCAAGAACAAGGAAGGTGTTCAGTAGTAAACAAAG
TACATTGGCAGAACCATGAAGTGTGCGACAATGAAGTAAACGTTGGTGTTTTACTCTATG
GTCGGTCTTATGTTAGGTTCCGAATGGTAGCAGAATCACATGGAAAAGGCCTTAAAAACT
TTGTATAACAAAATCTTAGACGCCATCATTGCATTTTTGACTAACGGCACTATTGATTAA
CTGAGCAATGGTTTCCAGTTTCAAGTAACGACGACTCAGATTGATATTAATCGAAAAAAA
AGGCGCTCACTCACTCGTAGAATCTACTCAGGAAAGCTAAGCTAGACGCCTCTTTTTAAT
GCTTTATCTTTACTGGCACACGCTGATGGCTGCCAAAGATTCTGCTGAACTTTGGAAGCG
TCCAGCGAGCGCGGAGATTACTTTTCAAACTTGTACGTTCTACGTTTTCGGTCTTGGCTT
TTCGTGCAGTAAGGACTCTCAATTCCCGGGTCACTGATTTTTGCCCTTTGAAAAGCGATG
AGTTAATTGAGTAAGTCTACTAGTAGTTGTAAGGCCCTATAGCTCCTGGAAAAATCACAG
GTTGGTATCTCAGGAAGCGTGGTGCAAGCGCGGAATAATTCATAATGCGAATTTAAGCCC
GACCTTGATGGTCTGGGGCGTTTAACGAAATATCACGTTCTCTTTACAGGTTTAGAATTT
AAGATCCTAGATTTGATCATGTGAACTACAGATGCTAATTTGAGACCTACTAGATAAAAC
CGGAAGCTTTCAATGGGCATTGCTAAGCTTGTCCGCTGCAATCCCGTTAAATGCAATTGG
AGCTCTACAGGATCCATACCATCGCGCGATAGAAAGAGAAGACGGGCACTTGTAAAAACC
CGCTGTATTGTGAAGTTTCTGACGCTACGTTGTGCCCCATGTAATTGGAAAACGAGCATG
CATGTAGTTGTGCCCTAGGCAAGAACGTCTTTGGAACCTATCTACGAAAGACGCGAGCAT
ATAGTATAGAACACAGGACAGTCAAATCCCGAAGTTTCCAGTGTTCATCACTATAATTAT
AAAACACCG

The gene Kwal_27.10259 (267266..267478) is annotated in this region but switched OFF
[contig 37] FULL