>Intergenic-Kwal_27.10219-Kwal_27.10224 kwal_s_27 (247716..248036) 321bp
TGAATTATAGATTTCGCAGCACTGGAGACGAATCTGGCGAATCTGGAGAATGGCAGATCA
ATTCCCTCTCTATACGGGATGAGATTCACCAACAAATCAGTAGTTGTATACCAAGAATAC
AGGCCGAGTTTAAGCTAGCGGGCCATTTAATTGAATAGGTTAGTCTTCAATGGTCCCAAT
CCCAAATACCGTATGTGATTTCGTTACCTACTGAGGTCTTAGAAATCACAATGAACGTCT
TTTTTTTCGAATTATCGGCGCTATGATGCACACAAGAGTTGGTAGTCGGCTCAATAGCGT
AAGATATCCGCTAACTAGACT

The gene Kwal_27.10222 complement(247941..248252) is annotated in this region but switched OFF
[contig 39] FULL