>Intergenic-Kwal_26.8001-Kwal_26.7996 kwal_s_26 complement(606819..607533) 715bp
TCTTAAGTCATTGCGTCTCGTGCTCACTTCCTTCCTTTGACACAGTCCGTGATTATGTAA
AATATCTCCGTGGGTCGGTTGCTCTAAAATTACTTTATCTTCCTTCGAGAATCACCGAGG
AGATGTAACTTTACGAAAGTCCGTTGCTTCGATAAAGCAAATCATTCATATTATCTTTCA
GTGGGTCCTATCTAATGTCCGCTATCAGGCAGAACTTCGGTCCTATGTTTCATACCCTCA
GCACCTAGGCCAGTGACACTCTAATTCATACGCTCAGCACCTAGGCTAGCGGCCTTTGGA
TGCTGGACAATTAGGAGGTTATCTCATCTCTCATGATTTTTTTGGCTTAATCTTCATTAA
AGTTTAGATTAAACGAGATAAGGCATGACATGTGACATCTGGGCTCTTCAACTTAATTTT
TTACTTATTCTTCAGGGTTCAAGGCGCCAAGGAAGAAACTGTGGCATTTTTTTAATAAGA
AGCAGTTTCTTTATACAAAGAATCAAGAGAGAGACATAAAAACTTTGGAACTTGTGTAAC
CGAGTTCAAGGCCACCACAGATTGGTAAAGACAATAGGGCAACGGTAGTAGGTGTGCGAG
TTTTGCAGTGGAAAGACGTGACAAAAAAAGATATTAAAGCACGGTATCGGAATCCGTTGG
AAAACAAAATTGCTGTTTAGTTTTGACACATACTAGCCATACCCATTCTAACGCA

The gene Kwal_26.7999 (606649..606900) is annotated in this region but switched OFF
[contig 55] FULL