>Intergenic-YPR122W-YPR124W scer_Chr_16 (785672..786207) 536bp
ACCGTATTTTGCTCGTTCCAGCCTTTCCACGTTTTTGTTATCTAAGCAACTTGGCACATT
TCCCTACTATACTACAAACCGATACGTAAATACTTCCCTAAATAGCATATGAATTATTCA
GTAATTTTTAAGGATCGAAACTGCACCTCAACTATTCGTTACTGTGGTTATGTTCTCATG
TATTGATGCAAATCATGGGATATTTGCTCAAGACGACGGTAAAATGAGCAAAAATGGCAC
GATCCTGAAAAGAGCACTTTTCAAGATTCGGGCTACAAAATGCAACATAAAAAATGTTGT
ATTGTCATCTCGAGAGGGTCTTGTATGTTTTATTCCTCTTATGATTAGTTCACATTAGTA
AAACAGATACGCAGTGTGCTCTTAATAAACAACTACTCCATAGCTTTATTTGCATAACAA
AACTTTTAAGCACAAACTTAAACAGGTGGAGTAATAGTTCGGCGGCGACTCAAATTACAT
TTGTTGGAAGAATCGAATAGAAAATAAAAAAAAGTGTATTATATTTGACATTCAAA

The gene YPR123C complement(786141..786575) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially/completely overlaps the verified ORF CTR