>Intergenic-YPL260W-YPL262W scer_Chr_16 complement(48803..49302) 500bp
GCTCTTTTTAGACAGTTATTCTCTTCTAATACAATTTCAGCGTTTTAAAAATTGGGAAAG
TCCTCGAAGATTTAGTAGTTCTTTTCCTTTGCTTTTGTTTGTTTTTAAACCGATATTTGC
TGCTAAACTTCTTAAAGAGATTTGCTCTTCTGGTGTACTCTCTTATTCGTTATCATTTCT
GAAAATTCCCCTTTCCGTGATGCGGGTAATACTAGGTCCCTTACCCGACGACAAGAAATT
AAAAAATGACGCAAAATATTCATTTATGAACTATTTTATTATAACTTGTATAGGAATAAT
AATGTAGTGATGTAAATTTATGGGCCCCATTAAGCCATCAAAAATGGAATGTATGCCTAT
GCTCCTCTTCTGACATAACTGGCCAGAGGCGGGACCTTAGCGGAGGGACCATTGCTGAAT
CACAAATTCTCTCCACTTCCTTATTTTCCTTCATATAATAAGACATAAAAAACTTGTATA
TTATTAGGTATTTAGCTCGT

The gene YPL261C complement(48996..49304) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein; partially overlaps the uncharacterized ORF YPL260W