>Intergenic-YOR380W-YOR378W scer_Chr_15 complement(1051059..1051289) 231bp
TTGGTGAGCTTAAAGTAGGAAAGTGTGCGCTAAGTTATCTTACTGAAGTTCTTTCAGGTT
TCTACTTGAAAAAATAATGTATCTTTTCACTCGAGAATGGCCTCTTGTAATTTTCATATT
TATCGCACGATACGGGATATACTGGCTCCTCTCTATCACTTTGATCGTACTATATTTATT
TCTATTAGTTTGGGTTATATACCACGATGAAGTATTTCTCTATATATGAAC

The gene YOR379C complement(1050726..1051064) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the uncharacterized ORF YOR378W