>Intergenic-YOR140W-YOR138C scer_Chr_15 complement(586325..586980) 656bp
GATTTTTTCTTCTTTTTTTCTATATAACTGATTTGTGCTGTCTTAGGACCCTCTGAATGT
ACCAAATAGTGTCGAATTACAATATTCTTTGTTATGTATATAGAGCTGAGTGCTTTGTGT
GCGTATGCGTATGTGTGTGTGTGTGAATTTTTTCCTTGAACCTGTCACTGTGGCGATGAA
GGTTCACTATGTTCTTTTTTCCCTGCTTTTCAAACTATCTTTGAAACTTTCCACTTCACA
CCAGTACGACTTCTTTGAAAAATTCGTAAGTCGAATAAATAATATTATTTCGCCGTGCGT
TTGTGTTTCTGTTTCAACAACCCTTTGTGTGCACCTGTATAGAGTGTTTAAAAAGAGATC
CTTCTTGCTAGCTGAAAAAGTTTATGTCGAATAAAAACGTCTTTTCATGTACTGAACATC
TGTTTTTCCGGCGGAGATGCAGCGATGGATGCGCTTGCTGCCAAGGCATCTGTGCCGGGC
GGGTGATGTCCGGGCGACCCGGCACGGAAGTAAAAGATACTATTGTTGAAAGGTACTTCT
CACTACAAGGCTTAAGGACCTGTCGGAGTAGAGGAAAGAAGAGAAGAAGCCGGAAAAGGA
GAGTCGTCACCTGTAAAAGGAATCTTAAGTAATTGATTTTTGTTAAGTAAGCTACG

The gene YOR139C complement(586950..587342) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the verified ORF SFL1/YOR140W