>Intergenic-YOR136W-YOR134W scer_Chr_15 complement(579794..580249) 456bp
TATTAAAAAATATTATAATTGTTGTTCGTTCCCGATCTGTATCTTATTATCTACCAAGGT
AATTCAGGTTCAGAAAAAGTGTATCCAATAATGTCATGCACTTGGAATATATATTTATAT
AAATATGAATAATAAATGAAAAAGAAATAAGAAAAGAGGAAAACTTTAGAAGGAGGGTTT
TTCTGATATGACTATGATGAGAAACTAAAACCTTAGGGCCTATAATAAGGGACCTATGAG
CTTTTCAATAACTTATATATTCTTTAACCAAACAATGGAAGTTACAGAAAATAGGAACTG
ACCAACCAGAGCGGCCCGTGTCATGCCCCCCCTTGCCGAGATGCGGACCGAGATTGCTGA
AAGAAGCGCCGAGTATCGCAAAAGGCCCCTGGCGGGGCAACGACAATTTCTTCGCCGAAC
CTCGGAATCGACTAGCAGATCACAGTGCTTAGGAAG

The gene YOR135C complement(580159..580500) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the verified gene YOR136W; null mutant displays increased levels of spontaneous Rad52 foci